quick update

y9c · Nov 16, 2024 · 14a23c1 · 14a23c1
1 parent 20a4f3c
commit 14a23c1
Show file tree

Hide file tree

Showing 2 changed files with 3 additions and 1 deletion.
diff --git a/cutseq/run.py b/cutseq/run.py
@@ -265,6 +265,8 @@ def __init__(self):
     "PBAT": "ACACGACGCTCTTCCGATCTXXXXXX<XXXXXXAGATCGGAAGAGCACACGTC",
     # Nextera, for ATAC-seq, without UMI
     "NEXTERA": "AGATGTGTATAAGAGACAG>CTGTCTCTTATACACATCT",
+    # Illumina Strand-Specific RNA-Seq Library Prep
+    "ILLUMINARNA": "AGATGTGTATAAGAGACAG<CTGTCTCTTATACACATCT",
 }
 
 

diff --git a/pyproject.toml b/pyproject.toml
@@ -1,6 +1,6 @@
 [tool.poetry]
 name = "cutseq"
-version = "0.0.55"
+version = "0.0.56"
 description = "Automatically cut adapter / barcode / UMI from NGS data"
 authors = ["Ye Chang <[email protected]>"]
 license = "MIT"