quick update

y9c · Nov 8, 2024 · 20a4f3c · 20a4f3c
1 parent dd8182c
commit 20a4f3c
Show file tree

Hide file tree

Showing 2 changed files with 3 additions and 1 deletion.
diff --git a/cutseq/run.py b/cutseq/run.py
@@ -243,6 +243,8 @@ def __init__(self):
     "ECLIP6": "ACACGACGCTCTTCCGATCTXX<XNNNNNNAGATCGGAAGAGCACACGTC",
     # eCLIP, SAC-seq, cDNA ligation method, with 10 nt UMI
     "ECLIP10": "ACACGACGCTCTTCCGATCTXX<XNNNNNNNNNNAGATCGGAAGAGCACACGTC",
+    # cDNA88, cDNA ligation method, with 8 nt UMI (left) and 8 nt UMI (right)
+    "SACSEQV3": "AGTTCTACAGTCCGACGATCTNNNNNNNNX>XXNNNNNNNNAGATCGGAAGAGCACACGTC",
     # p5 - [might be 6bp of polyC] - reverse insert (cDNA) - adaptase tail (CCCCCC) - p7
     # 6nt of polyG in 5' of R1 might from random RT primer
     # adaptase tail can be as long as 15bp at the 5' of R2 of polyG)

diff --git a/pyproject.toml b/pyproject.toml
@@ -1,6 +1,6 @@
 [tool.poetry]
 name = "cutseq"
-version = "0.0.54"
+version = "0.0.55"
 description = "Automatically cut adapter / barcode / UMI from NGS data"
 authors = ["Ye Chang <[email protected]>"]
 license = "MIT"