-
-
Notifications
You must be signed in to change notification settings - Fork 0
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
docs: add comprehensive adapter scheme documentation and update configs
- Loading branch information
Showing
3 changed files
with
268 additions
and
3 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,259 @@ | ||
# Adapter Schemes | ||
|
||
CutSeq supports various built-in adapter schemes for different NGS library preparation methods. Each scheme follows a general pattern: | ||
|
||
## Components | ||
|
||
- **p5/p7**: Illumina sequencing adapters (shown in <span style="color: #90EE90">light green</span>) | ||
- **inline5/3**: Fixed DNA barcode sequences in brackets () (shown in <span style="color: #FFD700">yellow</span>) | ||
- **umi5/3**: Random UMI sequences marked as N (shown in <span style="color: #FF6B6B">orange</span>) | ||
- **mask5/3**: Sequences to be masked marked as X (shown in <span style="color: #808080">gray</span>) | ||
- **strand**: Direction indicator (>, <, or -) (shown with <span style="color: #FF0000">red arrow</span>) | ||
|
||
## Built-in Schemes | ||
|
||
### DSLIGATION (dsDNA Ligation) | ||
<div class="adapter-scheme"> | ||
<div style="display: flex; align-items: center; font-family: monospace; margin: 20px 0;"> | ||
<span style="color: #90EE90">AGTTCTACAGTCCGACGATCT</span> | ||
<span style="color: #FF0000">></span> | ||
<span style="color: #90EE90">AGATCGGAAGAGCACACGTC</span> | ||
</div> | ||
</div> | ||
|
||
- Basic dsDNA ligation with A-tailing | ||
- Forward orientation | ||
- No UMIs or special trimming needed | ||
|
||
### SMALLRNA (Small RNA Libraries) | ||
<div class="adapter-scheme"> | ||
<div style="display: flex; align-items: center; font-family: monospace; margin: 20px 0;"> | ||
<span style="color: #90EE90">CACGACGCTCTTCCGATCT</span> | ||
<span style="color: #FF0000">></span> | ||
<span style="color: #90EE90">AGATCGGAAGAGCACACGTC</span> | ||
</div> | ||
</div> | ||
|
||
- Used for small RNA sequencing | ||
- Double ligation method | ||
- Forward orientation | ||
- Optional 2nt trimming on both ends for quality | ||
|
||
### INLINE (Custom Barcoded Libraries) | ||
<div class="adapter-scheme"> | ||
<div style="display: flex; align-items: center; font-family: monospace; margin: 20px 0;"> | ||
<span style="color: #90EE90">AGTTCTACAGTCCGACGATC</span> | ||
<span style="color: #FF6B6B">NNNNN</span> | ||
<span style="color: #FF0000">></span> | ||
<span style="color: #FF6B6B">NNNNN</span> | ||
<span style="color: #FFD700">(ATCACG)</span> | ||
<span style="color: #90EE90">AGATCGGAAGAGCACACGTC</span> | ||
</div> | ||
</div> | ||
|
||
- Used for libraries with inline barcodes | ||
- Dual UMI design (5nt each) | ||
- Forward orientation | ||
- Contains fixed barcode sequence | ||
|
||
### TAKARAV2 (SMARTer® Stranded Protocol V2) | ||
<div class="adapter-scheme"> | ||
<div style="display: flex; align-items: center; font-family: monospace; margin: 20px 0;"> | ||
<span style="color: #90EE90">ACACGACGCTCTTCCGATCT</span> | ||
<span style="color: #808080">XXX</span> | ||
<span style="color: #FF0000"><</span> | ||
<span style="color: #808080">XXX</span> | ||
<span style="color: #90EE90">AGATCGGAAGAGCACACGTC</span> | ||
</div> | ||
</div> | ||
|
||
- Earlier version of TAKARA stranded protocol | ||
- Includes masking for template switching artifacts | ||
- Reverse orientation to RNA | ||
- No UMI sequences | ||
|
||
### STRANDED (Generic Stranded RNA-seq) | ||
<div class="adapter-scheme"> | ||
<div style="display: flex; align-items: center; font-family: monospace; margin: 20px 0;"> | ||
<span style="color: #90EE90">ACACGACGCTCTTCCGATCT</span> | ||
<span style="color: #808080">X</span> | ||
<span style="color: #FF0000"><</span> | ||
<span style="color: #808080">XXX</span> | ||
<span style="color: #90EE90">AGATCGGAAGAGCACACGTC</span> | ||
</div> | ||
</div> | ||
|
||
- Basic stranded RNA-seq protocol | ||
- Minimal masking for ligation artifacts | ||
- Reverse orientation | ||
- No UMI sequences | ||
|
||
### TAKARAV3 (SMARTer® Stranded Total RNA-Seq Kit v3) | ||
<div class="adapter-scheme"> | ||
<div style="display: flex; align-items: center; font-family: monospace; margin: 20px 0;"> | ||
<span style="color: #90EE90">ACACGACGCTCTTCCGATCT</span> | ||
<span style="color: #808080">XXX</span> | ||
<span style="color: #FF0000"><</span> | ||
<span style="color: #808080">XXXXXX</span> | ||
<span style="color: #FF6B6B">NNNNNNNN</span> | ||
<span style="color: #90EE90">AGATCGGAAGAGCACACGTC</span> | ||
</div> | ||
</div> | ||
|
||
- Used for stranded RNA-seq | ||
- Contains 8nt UMI | ||
- Reverse orientation to RNA | ||
- Includes masking for template switching artifacts | ||
|
||
### ECLIP6 (eCLIP Protocol) | ||
<div class="adapter-scheme"> | ||
<div style="display: flex; align-items: center; font-family: monospace; margin: 20px 0;"> | ||
<span style="color: #90EE90">ACACGACGCTCTTCCGATCT</span> | ||
<span style="color: #808080">XX</span> | ||
<span style="color: #FF0000"><</span> | ||
<span style="color: #808080">X</span> | ||
<span style="color: #FF6B6B">NNNNNN</span> | ||
<span style="color: #90EE90">AGATCGGAAGAGCACACGTC</span> | ||
</div> | ||
</div> | ||
|
||
- Used for eCLIP and similar protocols | ||
- Contains 6nt UMI | ||
- Reverse orientation | ||
- Short masking regions | ||
|
||
### ECLIP10 (Extended eCLIP Protocol) | ||
<div class="adapter-scheme"> | ||
<div style="display: flex; align-items: center; font-family: monospace; margin: 20px 0;"> | ||
<span style="color: #90EE90">ACACGACGCTCTTCCGATCT</span> | ||
<span style="color: #808080">XX</span> | ||
<span style="color: #FF0000"><</span> | ||
<span style="color: #808080">X</span> | ||
<span style="color: #FF6B6B">NNNNNNNNNN</span> | ||
<span style="color: #90EE90">AGATCGGAAGAGCACACGTC</span> | ||
</div> | ||
</div> | ||
|
||
- Extended version of eCLIP protocol | ||
- Contains 10nt UMI for higher complexity | ||
- Reverse orientation | ||
- Short masking regions | ||
|
||
### SACSEQV3 (SAC-seq Protocol V3) | ||
<div class="adapter-scheme"> | ||
<div style="display: flex; align-items: center; font-family: monospace; margin: 20px 0;"> | ||
<span style="color: #90EE90">AGTTCTACAGTCCGACGATCT</span> | ||
<span style="color: #FF6B6B">NNNNNNNN</span> | ||
<span style="color: #808080">X</span> | ||
<span style="color: #FF0000">></span> | ||
<span style="color: #808080">XX</span> | ||
<span style="color: #FF6B6B">NNNNNNNN</span> | ||
<span style="color: #90EE90">AGATCGGAAGAGCACACGTC</span> | ||
</div> | ||
</div> | ||
|
||
- Dual UMI design (8nt each) | ||
- Forward orientation | ||
- Balanced masking on both sides | ||
- Used for high-complexity libraries | ||
|
||
### XGENRNA (xGen RNA Library Prep) | ||
<div class="adapter-scheme"> | ||
<div style="display: flex; align-items: center; font-family: monospace; margin: 20px 0;"> | ||
<span style="color: #90EE90">ACACGACGCTCTTCCGATCT</span> | ||
<span style="color: #808080">XXXXXX</span> | ||
<span style="color: #FF0000"><</span> | ||
<span style="color: #808080">XXXXXXXXXXXXXXX</span> | ||
<span style="color: #90EE90">AGATCGGAAGAGCACACGTC</span> | ||
</div> | ||
</div> | ||
|
||
- Handles polyC/G artifacts from random RT priming | ||
- Extended masking for adaptase tail (up to 15bp) | ||
- Reverse orientation | ||
- Uses random polyC tail as pseudo-UMI | ||
|
||
### XGENMETHY (xGen Methyl-Seq) | ||
<div class="adapter-scheme"> | ||
<div style="display: flex; align-items: center; font-family: monospace; margin: 20px 0;"> | ||
<span style="color: #90EE90">ACACGACGCTCTTCCGATCT</span> | ||
<span style="color: #808080">XX</span> | ||
<span style="color: #FF0000">></span> | ||
<span style="color: #808080">XXXXXXXXXX</span> | ||
<span style="color: #90EE90">AGATCGGAAGAGCACACGTC</span> | ||
</div> | ||
</div> | ||
|
||
- Designed for methylation sequencing | ||
- Trims 10 bases from read ends | ||
- Forward orientation | ||
- Includes random primer artifact removal | ||
|
||
### XGENSNMC (snmC-seq Protocol) | ||
<div class="adapter-scheme"> | ||
<div style="display: flex; align-items: center; font-family: monospace; margin: 20px 0;"> | ||
<span style="color: #90EE90">ACACGACGCTCTTCCGATCT</span> | ||
<span style="color: #808080">XXXXXX</span> | ||
<span style="color: #FF0000">></span> | ||
<span style="color: #808080">XXXXXXXXXXXXXXX</span> | ||
<span style="color: #90EE90">AGATCGGAAGAGCACACGTC</span> | ||
</div> | ||
</div> | ||
|
||
- Specialized for single-nucleus methylome sequencing | ||
- Extended 15-base trimming | ||
- Forward orientation | ||
- Heavy masking for protocol artifacts | ||
|
||
### PBAT (Post-Bisulfite Adapter Tagging) | ||
<div class="adapter-scheme"> | ||
<div style="display: flex; align-items: center; font-family: monospace; margin: 20px 0;"> | ||
<span style="color: #90EE90">ACACGACGCTCTTCCGATCT</span> | ||
<span style="color: #808080">XXXXXX</span> | ||
<span style="color: #FF0000"><</span> | ||
<span style="color: #808080">XXXXXX</span> | ||
<span style="color: #90EE90">AGATCGGAAGAGCACACGTC</span> | ||
</div> | ||
</div> | ||
|
||
- Used for post-bisulfite DNA sequencing | ||
- Random primer-based adapter addition | ||
- Reverse orientation | ||
- Symmetric masking for random tails | ||
|
||
### NEXTERA (ATAC-seq) | ||
<div class="adapter-scheme"> | ||
<div style="display: flex; align-items: center; font-family: monospace; margin: 20px 0;"> | ||
<span style="color: #90EE90">AGATGTGTATAAGAGACAG</span> | ||
<span style="color: #FF0000">></span> | ||
<span style="color: #90EE90">CTGTCTCTTATACACATCT</span> | ||
</div> | ||
</div> | ||
|
||
- Used for ATAC-seq libraries | ||
- Simple design without UMIs or barcodes | ||
- Forward orientation | ||
- Standard Nextera adapters | ||
|
||
### ILLUMINARNA (Illumina Stranded RNA-Seq) | ||
<div class="adapter-scheme"> | ||
<div style="display: flex; align-items: center; font-family: monospace; margin: 20px 0;"> | ||
<span style="color: #90EE90">AGATGTGTATAAGAGACAG</span> | ||
<span style="color: #FF0000"><</span> | ||
<span style="color: #90EE90">CTGTCTCTTATACACATCT</span> | ||
</div> | ||
</div> | ||
|
||
- Standard Illumina stranded RNA-seq protocol | ||
- Reverse orientation | ||
- Simple design without UMIs or masking | ||
- Direct adapter ligation method | ||
|
||
<style> | ||
.adapter-scheme { | ||
background: #f8f9fa; | ||
border-radius: 4px; | ||
padding: 10px; | ||
margin: 10px 0; | ||
} | ||
</style> |