Create cell-free parts package

Cell-free Parts/README.md

@@ -0,0 +1,58 @@
+# Package: Cell-free parts
+
+Contains all the major biomolecules required for a cell-free transcription-translation system providing them in an easy to express and purify way that anyone can easily produce for their experimental purposes.
+
+### Summary:
+
+- 42 parts
+    - CDS: 40
+    - designed_sequence: 2
+- 1 vectors
+- 39 samples for distribution _<span style="color:red">1 parts not included</span>_
+
+### Parts:
+
+- BBa_K2443000 (CDS) in pSB1C5
+- BBa_K2443001 (CDS) in pSB1C5
+- BBa_K2443002 (CDS) in pSB1C5
+- BBa_K2443003 (CDS) in pSB1C5
+- BBa_K2443004 (CDS) in pSB1C5
+- BBa_K2443005 (CDS) in pSB1C5
+- BBa_K2443006 (CDS) in pSB1C5
+- BBa_K2443007 (CDS) in pSB1C5
+- BBa_K2443008 (CDS) in pSB1C5
+- BBa_K2443009 (CDS) in pSB1C5
+- BBa_K2443010 (CDS) in pSB1C5
+- BBa_K2443011 (CDS) in pSB1C5
+- BBa_K2443012 (CDS) in pSB1C5
+- BBa_K2443013 (CDS) in pSB1C5
+- BBa_K2443014 (CDS) in pSB1C5
+- BBa_K2443015 (CDS) in pSB1C5
+- BBa_K2443016 (CDS) in pSB1C5
+- BBa_K2443017 (CDS) in pSB1C5
+- BBa_K2443018 (CDS) in pSB1C5
+- BBa_K2443019 (CDS) in pSB1C5
+- BBa_K2443020 (CDS) in pSB1C5
+- BBa_K2443021 (CDS) in pSB1C5
+- BBa_K2443022 (CDS) in pSB1C5
+- BBa_K2443023 (CDS) in pSB1C5
+- BBa_K2443024 (CDS) in pSB1C5
+- BBa_K2443025 (CDS) in pSB1C5
+- BBa_K2443026 (CDS) in pSB1C5
+- BBa_K2443027 (CDS) in pSB1C5
+- BBa_K2443028 (CDS) in pSB1C5
+- BBa_K2443029 (CDS) in pSB1C5
+- BBa_K2443030 (CDS) in pSB1C5
+- BBa_K2443031 (CDS) in pSB1C5
+- BBa_K2443032 (CDS) in pSB1C5
+- BBa_K2443033 (CDS) in pSB1C5
+- BBa_K2443034 (CDS) in pSB1C5
+- BBa_K2443035 (CDS) in pSB1C5
+- BBa_K2443036 (CDS) in pSB1C5
+- BBa_K2443037 (CDS) in pSB1C5
+- BBa_K2443038 (CDS) in pSB1C5
+- Bba_K2443039 (CDS) _<span style="color:red">not included in distribution</span>_
+- D1005 (designed_sequence) in pSB1C5
+- D1006 (designed_sequence) in pSB1C5
+
+_Note: automatically generated from package Excel and sequence files; do not edit_

Cell-free Parts/views/Libraries and Composites.csv

@@ -0,0 +1,20 @@
+Blue = Do not change; Green = free text,,,,,,,,,,,,,,,,,,,,,,,,,
+Example Data,,,,,,,,,,,,,,,,,,,,,,,,,
+Anderson library,Library specified as a list of 20 single parts,,True,pOpen_v4,,"J23100, J23101, J23102, J23103, J23104, J23105, J23106, J23107, J23108, J2309, J23110, J23111, J23112, J23113, J23114, J23115, J23116, J23117, J2318, J23119",,,,,,,,,,,,,,,,,,,
+GFP expression cassette,RBS + CDS + terminator ,,False,,,B0032,E0040,B0015,,,,,,,,,,,,,,,,,
+High/med/low plasmids,Plasmid library with 3 promoter options,,False,pSB1C3,,"J23101, J23106, J23117",GFP expression cassette,,,,,,,,,,,,,,,,,,
+Interlab test strains,Library transformed into DH5-alpha,,True,,,High/med/low plasmids,,,,,,,,,,,,,,,,,,,
+Interlab positive control,All-in-one specification of a transformed construct,,True,pSB1C3,,J23151,B0032,E0040,B0015,,,,,,,,,,,,,,,,
+Interlab negative control,Transformation of a basic plasmid,,True,pSB1C3,,R0040,,,,,,,,,,,,,,,,,,,
+,,,,,,,,,,,,,,,,,,,,,,,,,
+,,Blue text column headers are optional,,,,,,,,,,,,,,,,,,,,,,,
+Libraries and Composite Parts,,Click on column headers for more information as to what to put into the column,,,,,,,,,,,,,,,,,,,,,,,
+"Short and human friendly name for the part, e.g., ""GFP Reporter""",Comments about design decisions. E.g. GC content or restriction sites removed,A description of how the part is meant to function and any information about the part that is not to do with how it was designed.,"True if this is a final product to be produced, false if this is an intermediate stage being specified for compactness","If the composite is being placed into a plasmid, provide the name of the plasmid. If the composite is being transformed into the genome, provide the name of the locus for incorporation.","Identity and strand constraints on parts, expressed as Part X RELATION Part Y, where RELATION is ""same as"", ""different from"", ""same orientation as"", ""different orientation from""","Part names (left to right: 5'->3') should match the names of other basic or composite parts. Add more columns as needed. Indicate alternatives with commas, RC(name) for reverse complement",,,,,,,,,,,,,,,,,,,
+Part/Library Name,Design Notes,Part Description,Final Product,Backbone/locus,Constraints,Part 1,Part 2,Part 3,Part 4,Part 5,Part 6,Part 7,Part 8,Part 9,,,,,,,,,,,
+Cell free parts,,,True,pSB1C5,,D1005,"AlaRS, ArgRS, AsnRS, AspRS,  CysRS, GlnRS, GluRS, GlyRS-Alpha-Subunit, GlyRS-Beta-Subunit, HisRS, IleRS, LeuRS, LysRS, MetRS, PheRS-Alpha-Subunit, PheRS-Beta-Subunit, ProRS, SerRS, ThrRS, TrpRS, TyrRS, ValRS, MTF, IF1, IF2, IF3, EF-G, EF-Tu, EF-Ts, RF1, RF2, RF3, RRF, MK, CK, NDK, Ppiase, T7 RNA Polymerase, tRNAPhe-MS2",D1006,,,,,,,,,,,,,,,,,
+,,,False,,,,,,,,,,,,,,,,,,,,,,
+,,,False,,,,,,,,,,,,,,,,,,,,,,
+,,,False,,,,,,,,,,,,,,,,,,,,,,
+,,,False,,,,,,,,,,,,,,,,,,,,,,
+,,,False,,,,,,,,,,,,,,,,,,,,,,
+,,,False,,,,,,,,,,,,,,,,,,,,,,

Cell-free Parts/views/Parts and Devices.csv

@@ -0,0 +1,62 @@
+Collection Name,Cell-free parts,,Blue = Do not change; Green = free text,,,,,,,,,
+Authors,"Yorgo EL MOUBAYED, Nikolaos Delkis",,,,,,,,,,,
+,,,,,,,,,,,,
+Collection Description,,,,,,,,,,,,
+Contains all the major biomolecules required for a cell-free transcription-translation system providing them in an easy to express and purify way that anyone can easily produce for their experimental purposes.,,,,,,,,,,,,
+,,,,,,,,,,,,
+Example Data,,,,,,,,,,,,
+J23101,Promoter,High consitutive promoter from Anderson library,,,iGEM registry,J23101,,Escherichia coli,False,False,0,
+pRO1600,Engineered Region,Designed with a high GC content for higher melting points,,plasmid used to test promoter strength in  E coli,SEVA,pSEVA247Y,Aequorea victoria,Escherichia coli,True,True,1279,GTGAAAGGCAGGCCGGTCCGTGGTGGCCACGGCCTCTAGGCCAGATCCAGCGGCATCTGGGTTAGTCGAGCGCGGGCCGCTTCCCATGTCTCACCAGGGCGAGCCTGTTTCGCGATCTCAGCATCTGAAATCTTCCCGGCCTTGCGCTTCGCTGGGGCCTTACCCACCGCCTTGGCGGGCTTCTTCGGTCCAAAACTGAACAACAGATGTGTGACCTTGCGCCCGGTCTTTCGCTGCGCCCACTCCACCTGTAGCGGGCTGTGCTCGTTGATCTGCGTCACGGCTGGATCAAGCACTCGCAACTTGAAGTCCTTGATCGAGGGATACCGGCCTTCCAGTTGAAACCACTTTCGCAGCTGGTCAATTTCTATTTCGCGCTGGCCGATGCTGTCCCATTGCATGAGCAGCTCGTAAAGCCTGATCGCGTGGGTGCTGTCCATCTTGGCCACGTCAGCCAAGGCGTATTTGGTGAACTGTTTGGTGAGTTCCGTCAGGTACGGCAGCATGTCTTTGGTGAACCTGAGTTCTACACGGCCCTCACCCTCCCGGTAGATGATTGTTTGCACCCAGCCGGTAATCATCACACTCGGTCTTTTCCCCTTGCCATTGGGCTCTTGGGTTAACCGGACTTCCCGCCGTTTCAGGCGCAGGGCCGCTTCTTTGAGCTGGTTGTAGGAAGATTCGATAGGGACACCCGCCATCGTCGCTATGTCCTCCGCCGTCACTGAATACATCACTTCATCGGTGACAGGCTCGCTCCTCTTCACCTGGCTAATACAGGCCAGAACGATCCGCTGTTCCTGAACACTGAGGCGATACGCGGCCTCGACCAGGGCATTGCTTTTGTAAACCATTGGGGGTGAGGCCACGTTCGACATTCCTTGTGTATAAGGGGACACTGTATCTGCGTCCCACAATACAACAAATCCGTCCCTTTACAACAACAAATCCGTCCCTTCTTAACAACAAATCCGTCCCTTAATGGCAACAAATCCGTCCCTTTTTAAACTCTACAGGCCACGGATTACGTGGCCTGTAGACGTCCTAAAAGGTTTAAAAGGGAAAAGGAAGAAAAGGGTGGAAACGCAAAAAACGCACCACTACGTGGCCCCGTTGGGGCCGCATTTGTGCCCCTGAAGGGGCGGGGGAGGCGTCTGGGCAATCCCCGTTTTACCAGTCCCCTATCGCCGCCTGAGAGGGCGCAGGAAGCGAGTAATCAGGGTATCGAGGCGGATTCACCCTTGGCGTCCAACCAGCGGCACCAGCGGCGCCTGAGAGG
+,,,,,,,,,,,,
+,Blue text column headers are optional,,,,,,,,,,,
+DNA Parts and Devices,Click on column headers for more information as to what to put into the column,,,,,,,,,,,
+"Short and human friendly name for the part, e.g., ""GFP Reporter""",This is the role of the part according to the sequence ontology (see Ontology tab for full list). Select from the drop down menu or type have it validated.,Comments about design decisions. E.g. GC content or restriction sites removed,"If no changes were made use Direct, otherwise say changes that were made (can choose for drop down menu)",A description of how the part is meant to function and any information about the part that is not to do with how it was designed.,Where is the information about this part coming from? Provide a tag and e.g. AG for an Addgene plasmid. Tags found in the Source Sheet,Where is the information about this part coming from? Provide a te.g. 87906 for an Addgene plasmid. This is interpreted together with the column to the left,"Where is the genetic information coming from, e.g. gene taken from Aequorea victoria if available add in strain name too. This should match the scientific name for the txid in the next column","Where will the part be used, e.g. construct for use in Escherichia coli 98NK2. Where available include the strain name. This should match the scientific name for the txid in the next column","True if this is a final product to be produced, false if this is an intermediate stage being specified for compactness",Whether or not the part is circular. Select TRUE (circular) or FALSE (linear).,Automatically calculated length of the sequence pasted to the right. Use this column for checking there are no paste errors.,The series of ATGCs that make up the part. Spaces can be used within the sequence but no other characters.
+Part Name,Role,Design Notes,Altered Sequence,Part Description,Data Source Prefix,Data Source ID,Source Organism,Target Organism,Final Product,Circular,length (bp),Sequence
+AlaRS,CDS,optimized for expression in E. coli,Codon Optimisation,Alanine tRNA synthetase responsible for attaching alanine onto its tRNA to form an aminoacyl-tRNA,iGEM registry,BBa_K2443000,,Escherichia coli,False,False,0,
+ArgRS,CDS,optimized for expression in E. coli,Codon Optimisation,Arginine tRNA synthetase responsible for attaching alanine onto its tRNA to form an aminoacyl-tRNA,iGEM registry,BBa_K2443001,,Escherichia coli,False,False,0,
+AsnRS,CDS,optimized for expression in E. coli,Codon Optimisation,Asparagine tRNA synthetase responsible for attaching alanine onto its tRNA to form an aminoacyl-tRNA,iGEM registry,BBa_K2443002,,Escherichia coli,False,False,0,
+AspRS,CDS,optimized for expression in E. coli,Codon Optimisation,Aspartic acid tRNA synthetase responsible for attaching alanine onto its tRNA to form an aminoacyl-tRNA,iGEM registry,BBa_K2443003,,Escherichia coli,False,False,0,
+CysRS,CDS,optimized for expression in E. coli,Codon Optimisation,Cysteine tRNA synthetase responsible for attaching alanine onto its tRNA to form an aminoacyl-tRNA,iGEM registry,BBa_K2443004,,Escherichia coli,False,False,0,
+GlnRS,CDS,optimized for expression in E. coli,Codon Optimisation,Glutamine tRNA synthetase responsible for attaching alanine onto its tRNA to form an aminoacyl-tRNA,iGEM registry,BBa_K2443005,,Escherichia coli,False,False,0,
+GluRS,CDS,optimized for expression in E. coli,Codon Optimisation,Glutamic acid tRNA synthetase responsible for attaching alanine onto its tRNA to form an aminoacyl-tRNA,iGEM registry,BBa_K2443006,,Escherichia coli,False,False,0,
+GlyRS-Alpha-Subunit,CDS,optimized for expression in E. coli,Codon Optimisation,Glycine tRNA synthetase responsible for attaching alanine onto its tRNA to form an aminoacyl-tRNA,iGEM registry,BBa_K2443007,,Escherichia coli,False,False,0,
+GlyRS-Beta-Subunit,CDS,optimized for expression in E. coli,Codon Optimisation,Glycine tRNA synthetase responsible for attaching alanine onto its tRNA to form an aminoacyl-tRNA,iGEM registry,BBa_K2443008,,Escherichia coli,False,False,0,
+HisRS,CDS,optimized for expression in E. coli,Codon Optimisation,Histidine tRNA synthetase responsible for attaching alanine onto its tRNA to form an aminoacyl-tRNA,iGEM registry,BBa_K2443009,,Escherichia coli,False,False,0,
+IleRS,CDS,optimized for expression in E. coli,Codon Optimisation,Isoleucine tRNA synthetase responsible for attaching alanine onto its tRNA to form an aminoacyl-tRNA,iGEM registry,BBa_K2443010,,Escherichia coli,False,False,0,
+LeuRS,CDS,optimized for expression in E. coli,Codon Optimisation,Leucine tRNA synthetase responsible for attaching alanine onto its tRNA to form an aminoacyl-tRNA,iGEM registry,BBa_K2443011,,Escherichia coli,False,False,0,
+LysRS,CDS,optimized for expression in E. coli,Codon Optimisation,Lysine tRNA synthetase responsible for attaching alanine onto its tRNA to form an aminoacyl-tRNA,iGEM registry,BBa_K2443012,,Escherichia coli,False,False,0,
+MetRS,CDS,optimized for expression in E. coli,Codon Optimisation,Methionine tRNA synthetase responsible for attaching alanine onto its tRNA to form an aminoacyl-tRNA,iGEM registry,BBa_K2443013,,Escherichia coli,False,False,0,
+PheRS-Alpha-Subunit,CDS,optimized for expression in E. coli,Codon Optimisation,Phenylalanine tRNA synthetase responsible for attaching alanine onto its tRNA to form an aminoacyl-tRNA,iGEM registry,BBa_K2443014,,Escherichia coli,False,False,0,
+PheRS-Beta-Subunit,CDS,optimized for expression in E. coli,Codon Optimisation,Phenylalanine tRNA synthetase responsible for attaching alanine onto its tRNA to form an aminoacyl-tRNA,iGEM registry,BBa_K2443015,,Escherichia coli,False,False,0,
+ProRS,CDS,optimized for expression in E. coli,Codon Optimisation,Proline tRNA synthetase responsible for attaching alanine onto its tRNA to form an aminoacyl-tRNA,iGEM registry,BBa_K2443016,,Escherichia coli,False,False,0,
+SerRS,CDS,optimized for expression in E. coli,Codon Optimisation,Serine tRNA synthetase responsible for attaching alanine onto its tRNA to form an aminoacyl-tRNA,iGEM registry,BBa_K2443017,,Escherichia coli,False,False,0,
+ThrRS,CDS,optimized for expression in E. coli,Codon Optimisation,Threonine tRNA synthetase responsible for attaching alanine onto its tRNA to form an aminoacyl-tRNA,iGEM registry,BBa_K2443018,,Escherichia coli,False,False,0,
+TrpRS,CDS,optimized for expression in E. coli,Codon Optimisation,Tryptophane tRNA synthetase responsible for attaching alanine onto its tRNA to form an aminoacyl-tRNA,iGEM registry,BBa_K2443019,,Escherichia coli,False,False,0,
+TyrRS,CDS,optimized for expression in E. coli,Codon Optimisation,Tyrosine tRNA synthetase responsible for attaching alanine onto its tRNA to form an aminoacyl-tRNA,iGEM registry,BBa_K2443020,,Escherichia coli,False,False,0,
+ValRS,CDS,optimized for expression in E. coli,Codon Optimisation,Valine tRNA synthetase responsible for attaching alanine onto its tRNA to form an aminoacyl-tRNA,iGEM registry,BBa_K2443021,,Escherichia coli,False,False,0,
+MTF,CDS,optimized for expression in E. coli,Codon Optimisation,Methionyl-tRNA transformyalse (MTF) is a zinc finger metal response element-binding transcription factor,iGEM registry,BBa_K2443022,,Escherichia coli,False,False,0,
+IF1,CDS,optimized for expression in E. coli,Codon Optimisation,Initiation factor 1,iGEM registry,BBa_K2443023,,Escherichia coli,False,False,0,
+IF2,CDS,optimized for expression in E. coli,Codon Optimisation,Initiation factor 2,iGEM registry,BBa_K2443024,,Escherichia coli,False,False,0,
+IF3,CDS,optimized for expression in E. coli,Codon Optimisation,Initiation factor 3,iGEM registry,BBa_K2443025,,Escherichia coli,False,False,0,
+EF-G,CDS,optimized for expression in E. coli,Codon Optimisation,Elongation factor G is a prokaryotic translocase and GTPase responsible for catalyzing and coordinating the movement of tRNA and mRNA through the ribosome,iGEM registry,BBa_K2443026,,Escherichia coli,False,False,0,
+EF-Tu,CDS,optimized for expression in E. coli,Codon Optimisation,EF-Tu (elongation factor thermo unstable) is a prokaryotic elongation factor which catalyzes the binding of an aminoacyl-tRNA (aa-tRNA) to the ribosome,iGEM registry,BBa_K2443027,,Escherichia coli,False,False,0,
+EF-Ts,CDS,optimized for expression in E. coli,Codon Optimisation,"EF-Ts is a prokaryotic elongation factors. EF-Ts acts at the guanine nucleotide exchange factor for EF-Tu, catalyzing the release of guanosine diphosphate from EF-Tu",iGEM registry,BBa_K2443028,,Escherichia coli,False,False,0,
+RF1,CDS,optimized for expression in E. coli,Codon Optimisation,Release factor 1 (RF1) allows for the termination of translation through the recognition of the stop codon in an mRNA sequence,iGEM registry,BBa_K2443029,,Escherichia coli,False,False,0,
+RF2,CDS,optimized for expression in E. coli,Codon Optimisation,Release factor 2 (RF2) allows for the termination of translation through the recognition of the stop codon in an mRNA sequence,iGEM registry,BBa_K2443030,,Escherichia coli,False,False,0,
+RF3,CDS,optimized for expression in E. coli,Codon Optimisation,Release factor 3 (RF3) allows for the termination of translation through the recognition of the stop codon in an mRNA sequence,iGEM registry,BBa_K2443031,,Escherichia coli,False,False,0,
+RRF,CDS,optimized for expression in E. coli,Codon Optimisation,Ribosome Recycling Factor (RRF) is responsible for recycling ribosomes after completion of protein synthesis,iGEM registry,BBa_K2443032,,Escherichia coli,False,False,0,
+MK,CDS,optimized for expression in E. coli,Codon Optimisation,"Myokinase (MK) is a phosphotransferase enzyme that is responsible for the catalyzing the interconversion of adenine nucleotides (ATP, ADP, and AMP)",iGEM registry,BBa_K2443033,,Escherichia coli,False,False,0,
+CK,CDS,optimized for expression in E. coli,Codon Optimisation,Creatine kinase (CK) is responsible for catalyzing the conversion of creatine. It has been Codon optimized for use in Escherichia coli and contains a C-terminal hexahistidine tag,iGEM registry,BBa_K2443034,,Escherichia coli,False,False,0,
+NDK,CDS,optimized for expression in E. coli,Codon Optimisation,NDK is responsible for the catalysis of the exchange of terminal phosphate between different nucleoside diphosphates (NDP) and triphosphates (NTP) in a reversible manner to produce nucleotide triphosphates,iGEM registry,BBa_K2443035,,Escherichia coli,False,False,0,
+Ppiase,CDS,optimized for expression in E. coli,Codon Optimisation,,iGEM registry,BBa_K2443036,,Escherichia coli,False,False,0,
+T7 RNA Polymerase,CDS,optimized for expression in E. coli,Codon Optimisation,T7 RNA Polymerase is responsible for transcribing DNA into RNA and is under the regulation of the T7 promoter consensus sequence,iGEM registry,BBa_K2443037,,Escherichia coli,False,False,0,
+tRNAPhe-MS2,CDS,optimized for expression in E. coli,Codon Optimisation,"tRNAPhe-MS2 co-purification construct. Contains a T7 promoter -10 followed by tRNA Phe, two MS2 RNA aptamers and a double terminator. To be used in conjunction with Bba_K2109108.",iGEM registry,BBa_K2443038,,Escherichia coli,False,False,0,
+EYFP-Spinach,CDS,,,Transcription and translation (TX-TL) measurement device,iGEM registry,Bba_K2443039,,Escherichia coli,False,False,0,
+pSB1C5,plasmid_vector,,,,iGEM registry,pSB1C5,,Escherichia coli,False,True,0,
+D1005,designed_sequence,,direct,,iGEM registry,D1005,,Escherichia coli,False,False,0,
+D1006,designed_sequence,,direct,,iGEM registry,D1006,,Escherichia coli,False,False,0,
+,,,,,,,,,,,,
+,,,,,,,,,,,,
+,,,,,,,,,,,,
+,,,,,,,,,,,,
+,,,,,,,,,,,,