SBOL3 to SBOL2 conversion of BBa_J23101 simple Component, Sequence, a…

…nd Activity

sbol_utilities/conversion.py

@@ -16,7 +16,7 @@
 from sbol_utilities.helper_functions import strip_sbol2_version, GENETIC_DESIGN_FILE_TYPES, \
     find_top_level
 from sbol_utilities.sbol3_genbank_conversion import GenBankSBOL3Converter
-from sbol_utilities.sbol3_sbol2_conversion import SBOL2SBOL3Converter
+import sbol_utilities.sbol3_sbol2_conversion
 from sbol_utilities.workarounds import id_sort
 
 # sbol javascript executable based on https://github.com/sboltools/sbolgraph
@@ -80,7 +80,7 @@ def convert2to3(sbol2_doc: Union[str, sbol2.Document], namespaces=None, use_nati
     :return: equivalent SBOL3 document
     """
     if use_native_converter:
-        return SBOL2SBOL3Converter.convert2to3(sbol2_doc)
+        return sbol_utilities.sbol3_sbol2_conversion.convert2to3(sbol2_doc)
 
     # if we've started with a Document in memory, write it to a temp file
     if namespaces is None:
@@ -181,7 +181,7 @@ def convert3to2(doc3: sbol3.Document, use_native_converter: bool = False) -> sbo
     :return: equivalent SBOL2 document
     """
     if use_native_converter:
-        return SBOL2SBOL3Converter.convert3to2(doc3)
+        return sbol_utilities.sbol3_sbol2_conversion.convert3to2(doc3)
 
     # TODO: remove workarounds after conversion errors fixed in https://github.com/sboltools/sbolgraph/issues/16
     # remap sequence encodings:

sbol_utilities/sbol3_sbol2_conversion.py

@@ -1,36 +1,100 @@
 import sbol3
 import sbol2
 
-SBOL2_VERSION_PREDICATE = 'http://sboltools.org/backport#sbol2version'
+# Namespaces
+from rdflib import URIRef
 
+BACKPORT_NAMESPACE = 'http://sboltools.org/backport#'
+BACKPORT2_VERSION = f'{BACKPORT_NAMESPACE}sbol2version'
+BACKPORT3_NAMESPACE = f'{BACKPORT_NAMESPACE}sbol3namespace'
 
-class SBOL3ConverterVisitor:
+NON_EXTENSION_PROPERTY_PREFIXES = {sbol3.SBOL3_NS, sbol3.SBOL2_NS,  # SBOL 2 & 3 namespaces
+                                   sbol3.RDF_NS, sbol3.PROV_NS, sbol3.OM_NS,  # Standard ontologies
+                                   BACKPORT_NAMESPACE}  # Information added by this converter
 
-    doc2: sbol2.Document
 
-    def __init__(self, doc2: sbol2.Document):
-        self.doc2 = doc2
+class SBOL3To2ConversionVisitor:
+    """This class is used to map every object in an SBOL3 document into an empty SBOL2 document"""
 
-    def _convert_extension_properties(self, obj: sbol2.Identified):
-        """Map over the other properties of an extension materials"""
-        pass
+    doc2: sbol2.Document
 
-    def _convert_identified(self, obj: sbol2.Identified):
+    def __init__(self, doc3: sbol3.Document):
+        # Create the target document
+        self.doc2 = sbol2.Document()
+        #   # Immediately run the conversion
+        self._convert(doc3)
+
+    def _convert(self, doc3: sbol3.Document):
+        # Bind standard namespaces that aren't bound by default in pySBOL2
+        self.doc2.addNamespace(BACKPORT_NAMESPACE, 'backport')
+        self.doc2.addNamespace(sbol3.PROV_NS, 'prov')
+        self.doc2.addNamespace(sbol3.OM_NS, 'om')
+        self.doc2.addNamespace('http://purl.org/dc/terms/', 'dcterms')
+
+        # Override parameters that will otherwise interfere in conversion, saving old values
+        saved_compliance = sbol2.Config.getOption(sbol2.ConfigOptions.SBOL_COMPLIANT_URIS.value)
+        sbol2.Config.setOption(sbol2.ConfigOptions.SBOL_COMPLIANT_URIS.value, False)
+        saved_homespace = sbol2.getHomespace()
+        sbol2.setHomespace('')
+
+        # Try conversion, resetting saved parameter values afterward
+        try:
+            doc3.accept(self)
+        finally:
+            sbol2.Config.setOption(sbol2.ConfigOptions.SBOL_COMPLIANT_URIS.value, saved_compliance)
+            sbol2.setHomespace(saved_homespace)
+
+    @staticmethod
+    def _convert_extension_properties(obj3: sbol3.Identified, obj2: sbol2.Identified):
+        """Copy over extension properties"""
+        extension_properties = (p for p in obj3.properties
+                                if not any(p.startswith(prefix) for prefix in NON_EXTENSION_PROPERTY_PREFIXES))
+        for p in extension_properties:
+            obj2.properties[p] = obj3._properties[p]  # Can't use setPropertyValue because it may not be a string
+
+    def _convert_identified(self, obj3: sbol3.Identified, obj2: sbol2.Identified):
         """Map over the other properties of an identified object"""
+        self._convert_extension_properties(obj3, obj2)
+        # Map over equivalent properties
+        obj2.displayId = obj3.display_id
+        obj2.name = obj3.name
+        obj2.description = obj3.description
+        obj2.wasDerivedFrom = obj3.derived_from
+        obj2.wasGeneratedBy = obj3.generated_by
+        # Turn measures into extension properties
+        if obj3.measures:
+            raise NotImplementedError('Conversion of measures from SBOL3 to SBOL2 not yet implemented')
         pass
 
-    def _convert_toplevel(self, obj: sbol2.TopLevel):
-        """Map over the other properties of a toplevel object"""
-        self._convert_identified(obj)
-        pass
+    def _convert_toplevel(self, obj3: sbol3.TopLevel, obj2: sbol2.TopLevel):
+        """Map over the other properties of a TopLevel object"""
+        self._convert_identified(obj3, obj2)
+        obj2.attachments = [a.identity for a in obj3.attachments]
+        obj2.properties[BACKPORT3_NAMESPACE] = [URIRef(obj3.namespace)]
 
     @staticmethod
     def _sbol2_version(obj: sbol3.Identified):
-        obj.sbol2_version = sbol3.TextProperty(obj, SBOL2_VERSION_PREDICATE, 0, 1)
+        obj.sbol2_version = sbol3.TextProperty(obj, BACKPORT2_VERSION, 0, 1)
         return obj.sbol2_version or '1'
 
-    def visit_activity(self, a: sbol3.Activity):
-        raise NotImplementedError('Conversion of Activity from SBOL3 to SBOL2 not yet implemented')
+    def visit_activity(self, act3: sbol3.Activity):
+        # Make the Activity object and add it to the document
+        act2 = sbol2.Activity(act3.identity, version=self._sbol2_version(act3))
+        if act3.types:
+            if len(act3.types) > 1:
+                raise NotImplementedError('Conversion of multi-type activities to SBOL2 not yet implemented:'
+                                          'pySBOL2 currently supports a maximum of one type per activity'
+                                          'Bug: https://github.com/SynBioDex/pySBOL2/issues/428')
+            act2.types = act3.types[0]  # Take first type from list of length 1
+        act2.startedAtTime = act3.start_time
+        act2.endedAtTime = act3.end_time
+        act2.usages = act3.usage
+        act2.associations = act3.association
+        # TODO: pySBOL3 is currently missing wasInformedBy (https://github.com/SynBioDex/pySBOL3/issues/436
+        # act2.wasInformedBy = act3.informed_by
+        self.doc2.activities.add(act2)
+        # Map over all other TopLevel properties and extensions not covered by the constructor
+        self._convert_toplevel(act3, act2)
 
     def visit_agent(self, a: sbol3.Agent):
         raise NotImplementedError('Conversion of Agent from SBOL3 to SBOL2 not yet implemented')
@@ -50,8 +114,32 @@ def visit_collection(self, a: sbol3.Collection):
     def visit_combinatorial_derivation(self, a: sbol3.CombinatorialDerivation):
         raise NotImplementedError('Conversion of CombinatorialDerivation from SBOL3 to SBOL2 not yet implemented')
 
-    def visit_component(self, a: sbol3.Component):
-        raise NotImplementedError('Conversion of Component from SBOL3 to SBOL2 not yet implemented')
+    def visit_component(self, cp3: sbol3.Component):
+        # Remap type if it's one of the ones that needs remapping; otherwise pass through unchanged
+        type_map = {sbol3.SBO_DNA: sbol2.BIOPAX_DNA,  # TODO: distinguish biopax Dna from DnaRegion
+                    sbol3.SBO_RNA: sbol2.BIOPAX_RNA,  # TODO: distinguish biopax Rna from RnaRegion
+                    sbol3.SBO_PROTEIN: sbol2.BIOPAX_PROTEIN,
+                    sbol3.SBO_SIMPLE_CHEMICAL: sbol2.BIOPAX_SMALL_MOLECULE,
+                    sbol3.SBO_NON_COVALENT_COMPLEX: sbol2.BIOPAX_COMPLEX}
+        types2 = [type_map.get(t, t) for t in cp3.types]
+        # Make the Component object and add it to the document
+        cp2 = sbol2.ComponentDefinition(cp3.identity, types2, version=self._sbol2_version(cp3))
+        self.doc2.addComponentDefinition(cp2)
+        # Convert the Component properties not covered by the constructor
+        cp2.roles = cp3.roles
+        cp2.sequences = cp3.sequences
+        if cp3.features:
+            raise NotImplementedError('Conversion of Component features from SBOL3 to SBOL2 not yet implemented')
+        if cp3.interactions:
+            raise NotImplementedError('Conversion of Component interactions from SBOL3 to SBOL2 not yet implemented')
+        if cp3.constraints:
+            raise NotImplementedError('Conversion of Component constraints from SBOL3 to SBOL2 not yet implemented')
+        if cp3.interface:
+            raise NotImplementedError('Conversion of Component interface from SBOL3 to SBOL2 not yet implemented')
+        if cp3.models:
+            raise NotImplementedError('Conversion of Component models from SBOL3 to SBOL2 not yet implemented')
+        # Map over all other TopLevel properties and extensions not covered by the constructor
+        self._convert_toplevel(cp3, cp2)
 
     def visit_component_reference(self, a: sbol3.ComponentReference):
         raise NotImplementedError('Conversion of ComponentReference from SBOL3 to SBOL2 not yet implemented')
@@ -62,8 +150,9 @@ def visit_constraint(self, a: sbol3.Constraint):
     def visit_cut(self, a: sbol3.Cut):
         raise NotImplementedError('Conversion of Cut from SBOL3 to SBOL2 not yet implemented')
 
-    def visit_document(self, a: sbol3.Document):
-        raise NotImplementedError('Conversion of Document from SBOL3 to SBOL2 not yet implemented')
+    def visit_document(self, doc3: sbol3.Document):
+        for obj in doc3.objects:
+            obj.accept(self)
 
     def visit_entire_sequence(self, a: sbol3.EntireSequence):
         raise NotImplementedError('Conversion of EntireSequence from SBOL3 to SBOL2 not yet implemented')
@@ -110,12 +199,17 @@ def visit_range(self, a: sbol3.Range):
     def visit_si_prefix(self, a: sbol3.SIPrefix):
         raise NotImplementedError('Conversion of SIPrefix from SBOL3 to SBOL2 not yet implemented')
 
-    def visit_sequence(self, seq: sbol3.Sequence):
+    def visit_sequence(self, seq3: sbol3.Sequence):
+        # Remap encoding if it's one of the ones that needs remapping; otherwise pass through unchanged
+        encoding_map = {sbol3.IUPAC_DNA_ENCODING: sbol2.SBOL_ENCODING_IUPAC,
+                        sbol3.IUPAC_PROTEIN_ENCODING: sbol2.SBOL_ENCODING_IUPAC_PROTEIN,
+                        sbol3.SMILES_ENCODING: sbol2.SBOL_ENCODING_SMILES}
+        encoding2 = encoding_map.get(seq3.encoding, seq3.encoding)
         # Make the Sequence object and add it to the document
-        seq = sbol2.Sequence(seq.identity, seq.elements, encoding=seq.encoding, version=self._sbol2_version(seq))
-        self.doc2.addSequence(seq)
-        # Add all of the other TopLevel properties and extensions not already covered
-        self._convert_toplevel(seq)
+        seq2 = sbol2.Sequence(seq3.identity, seq3.elements, encoding=encoding2, version=self._sbol2_version(seq3))
+        self.doc2.addSequence(seq2)
+        # Map over all other TopLevel properties and extensions not covered by the constructor
+        self._convert_toplevel(seq3, seq2)
 
     def visit_sequence_feature(self, a: sbol3.SequenceFeature):
         raise NotImplementedError('Conversion of SequenceFeature from SBOL3 to SBOL2 not yet implemented')
@@ -142,25 +236,22 @@ def visit_variable_feature(self, a: sbol3.VariableFeature):
         raise NotImplementedError('Conversion of VariableFeature from SBOL3 to SBOL2 not yet implemented')
 
 
-class SBOL2SBOL3Converter:
-    @staticmethod
-    def convert3to2(doc3: sbol3.Document) -> sbol2.Document:
-        """Convert an SBOL3 document to an SBOL2 document
+def convert3to2(doc3: sbol3.Document) -> sbol2.Document:
+    """Convert an SBOL3 document to an SBOL2 document
 
-        :param doc3: SBOL3 document to convert
-        :returns: SBOL2 document
-        """
-        doc2 = sbol2.Document()
-        doc3.accept(SBOL3ConverterVisitor(doc2))
-        return doc2
+    :param doc3: SBOL3 document to convert
+    :returns: SBOL2 document
+    """
+    converter = SBOL3To2ConversionVisitor(doc3)
+    return converter.doc2
 
-    @staticmethod
-    def convert2to3(doc2: sbol2.Document) -> sbol3.Document:
-        """Convert an SBOL2 document to an SBOL3 document
-
-        :param doc2: SBOL2 document to convert
-        :returns: SBOL3 document
-        """
-        doc3 = sbol3.Document()
-        # TODO: build converter here
-        return doc3
+
+def convert2to3(doc2: sbol2.Document) -> sbol3.Document:
+    """Convert an SBOL2 document to an SBOL3 document
+
+    :param doc2: SBOL2 document to convert
+    :returns: SBOL3 document
+    """
+    doc3 = sbol3.Document()
+    # TODO: build converter here
+    return doc3

test/test_files/BBa_J23101.xml

@@ -0,0 +1,62 @@
+<rdf:RDF xmlns:owl="http://www.w3.org/2002/07/owl#" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" xmlns:rdfs="http://www.w3.org/2000/01/rdf-schema#" xmlns:xsd="http://www.w3.org/2001/XMLSchema#" xmlns:backport="http://sboltools.org/backport#" xmlns:prov="http://www.w3.org/ns/prov#" xmlns:om="http://www.ontology-of-units-of-measure.org/resource/om-2/" xmlns:dcterms="http://purl.org/dc/terms/" xmlns:sbol="http://sbols.org/v2#" xmlns:ns0="http://wiki.synbiohub.org/wiki/Terms/synbiohub#" xmlns:ns1="http://purl.org/dc/elements/1.1/" xmlns:ns2="http://wiki.synbiohub.org/wiki/Terms/igem#">
+  <sbol:ComponentDefinition rdf:about="https://synbiohub.org/public/igem/BBa_J23101">
+    <ns0:mutableDescription>later</ns0:mutableDescription>
+    <ns0:ownedBy rdf:resource="https://synbiohub.org/user/myers"/>
+    <sbol:type rdf:resource="http://www.biopax.org/release/biopax-level3.owl#DnaRegion"/>
+    <sbol:version>1</sbol:version>
+    <ns0:mutableNotes>N/A</ns0:mutableNotes>
+    <ns2:sampleStatus>In stock</ns2:sampleStatus>
+    <dcterms:title>BBa_J23101</dcterms:title>
+    <ns2:partStatus>Released HQ 2013</ns2:partStatus>
+    <ns0:bookmark>true</ns0:bookmark>
+    <ns0:mutableProvenance>later</ns0:mutableProvenance>
+    <ns0:topLevel rdf:resource="https://synbiohub.org/public/igem/BBa_J23101"/>
+    <ns2:dominant>true</ns2:dominant>
+    <sbol:role rdf:resource="http://identifiers.org/so/SO:0000167"/>
+    <ns0:star>true</ns0:star>
+    <ns0:ownedBy rdf:resource="https://synbiohub.org/user/james"/>
+    <backport:sbol3namespace rdf:resource="https://synbiohub.org"/>
+    <prov:wasDerivedFrom rdf:resource="http://parts.igem.org/Part:BBa_J23101"/>
+    <ns2:discontinued>false</ns2:discontinued>
+    <dcterms:modified>2015-08-31T04:08:40Z</dcterms:modified>
+    <sbol:persistentIdentity rdf:resource="https://synbiohub.org/public/igem/BBa_J23101"/>
+    <dcterms:created>2006-08-03T11:00:00Z</dcterms:created>
+    <sbol:sequence rdf:resource="https://synbiohub.org/public/igem/BBa_J23101_sequence"/>
+    <sbol:displayId>BBa_J23101</sbol:displayId>
+    <dcterms:description>constitutive promoter family member</dcterms:description>
+    <ns2:status rdf:resource="http://wiki.synbiohub.org/wiki/Terms/igem#status/Available"/>
+    <sbol:role rdf:resource="http://wiki.synbiohub.org/wiki/Terms/igem#partType/Regulatory"/>
+    <ns2:owner_id>483</ns2:owner_id>
+    <ns2:owning_group_id>95</ns2:owning_group_id>
+    <ns2:group_u_list>_52_</ns2:group_u_list>
+    <prov:wasGeneratedBy rdf:resource="https://synbiohub.org/public/igem/igem2sbol"/>
+    <ns1:creator>John Anderson</ns1:creator>
+    <ns2:m_user_id>0</ns2:m_user_id>
+    <ns2:experience rdf:resource="http://wiki.synbiohub.org/wiki/Terms/igem#experience/Works"/>
+  </sbol:ComponentDefinition>
+  <sbol:Sequence rdf:about="https://synbiohub.org/public/igem/BBa_J23101_sequence">
+    <sbol:displayId>BBa_J23101_sequence</sbol:displayId>
+    <ns0:ownedBy rdf:resource="https://synbiohub.org/user/james"/>
+    <backport:sbol3namespace rdf:resource="https://synbiohub.org"/>
+    <sbol:persistentIdentity rdf:resource="https://synbiohub.org/public/igem/BBa_J23101_sequence"/>
+    <prov:wasDerivedFrom rdf:resource="http://parts.igem.org/Part:BBa_J23101"/>
+    <prov:wasGeneratedBy rdf:resource="https://synbiohub.org/public/igem/igem2sbol"/>
+    <ns0:topLevel rdf:resource="https://synbiohub.org/public/igem/BBa_J23101_sequence"/>
+    <sbol:encoding rdf:resource="http://www.chem.qmul.ac.uk/iubmb/misc/naseq.html"/>
+    <sbol:elements>tttacagctagctcagtcctaggtattatgctagc</sbol:elements>
+    <ns0:ownedBy rdf:resource="https://synbiohub.org/user/myers"/>
+    <sbol:version>1</sbol:version>
+  </sbol:Sequence>
+  <prov:Activity rdf:about="https://synbiohub.org/public/igem/igem2sbol">
+    <ns1:creator>Chris J. Myers</ns1:creator>
+    <ns0:ownedBy rdf:resource="https://synbiohub.org/user/myers"/>
+    <prov:endedAtTime>2017-03-06T15:00:00+00:00</prov:endedAtTime>
+    <sbol:version>1</sbol:version>
+    <ns0:topLevel rdf:resource="https://synbiohub.org/public/igem/igem2sbol"/>
+    <backport:sbol3namespace rdf:resource="https://synbiohub.org"/>
+    <ns1:creator>James Alastair McLaughlin</ns1:creator>
+    <ns0:ownedBy rdf:resource="https://synbiohub.org/user/james"/>
+    <sbol:persistentIdentity rdf:resource="https://synbiohub.org/public/igem/igem2sbol"/>
+    <sbol:displayId>igem2sbol</sbol:displayId>
+  </prov:Activity>
+</rdf:RDF>

test/test_sbol2_sbol3_direct.py

@@ -0,0 +1,30 @@
+import tempfile
+from pathlib import Path
+
+import unittest
+
+import sbol2
+import sbol3
+
+from sbol_utilities.conversion import convert2to3, convert3to2
+from sbol_utilities.sbol_diff import file_diff
+
+TEST_FILES = Path(__file__).parent / 'test_files'
+
+
+class TestDirectSBOL2SBOL3Conversion(unittest.TestCase):
+
+    def test_3to2_conversion(self):
+        """Test ability to convert a simple part from SBOL3 to SBOL2"""
+        # Load an SBOL3 document and check its contents
+        doc3 = sbol3.Document()
+        doc3.read(TEST_FILES / 'BBa_J23101.nt')
+        # Convert to SBOL2 and check contents
+        doc2 = convert3to2(doc3, True)
+        with tempfile.NamedTemporaryFile(suffix='.xml') as tmp:
+            doc2.write(tmp.name)
+            self.assertFalse(file_diff(tmp.name, str(TEST_FILES / 'BBa_J23101.xml')))
+
+
+if __name__ == '__main__':
+    unittest.main()