Adapter Detection Issue with Paired-End Data in fastp Leading to Incomplete Trimming

[Liping-L]

Dear team,

This issue does not appear to be unique; please also refer to #557 #558 .

I encountered this while processing paired-end (PE) data and identifying the Illumina TruSeq Small RNA adapter "TGGAATTCTCGGGTGCCAAGG" in the sequences.

For paired-end data, fastp typically detects adapters automatically, which is an excellent feature. However, in my case, fastp (v0.23.1) identified the adapter sequences as “ATTCTCGGGTGCCAAGG......”—omitting the “TGGA” at the 5’ end—resulting in incomplete trimming.

I also attempted to specify the adapter sequences with the -a option, but per the manual, "For PE data, this is used if R1/R2 are found not overlapped".

### Details about the Sequencing Library:

Data Accession: NCBI-SRR488706
Methods & Materials (from related publication): Small RNAs had linkers ligated to them and bar-coded cDNAs were prepared using the TruSeq Small RNA Sample Prep Kit (Illumina) following the manufacturer's instructions. ..... 100 bp paired-end reads of the libraries were obtained.
Inserts size: Primarily 27 bp

Could you please advise on any potential solutions for this? Thank you!

Best,
Liping