How to Generate Haplotype 1 and 2 FASTA Files Using Phased VCF from HiPhase

[ClarenceHsiang]

Dear bcftools :
I attempted to use bcftools to generate haplotype sequences using the phased.vcf (from HiPhase), but the process was unsuccessful. Are there alternative solutions available? Below is the code I used:
bcftools consensus -f reference_genome.fasta -H 1 output_phased_variants.vcf.gz > haplotype1.fasta
bcftools consensus -f reference_genome.fasta -H 2 output_phased_variants.vcf.gz > haplotype2.fasta

The error information as below, May you give me some suggestion and help?

---

[Clarence]$ /data/share/tools/bcftools-1.9/bcftools consensus -f 221021hap1_assembly.fa -H 1 hap1.out_phased.vcf.gz > hap1_phased_haplotype1.fasta
The site Chr1_1:4195225 overlaps with another variant, skipping...
The site Chr1_1:4201421 overlaps with another variant, skipping...
The site Chr1_1:4202106 overlaps with another variant, skipping...
The site Chr1_1:28824762 overlaps with another variant, skipping...
The site Chr1_1:30388601 overlaps with another variant, skipping...
The fasta sequence does not match the REF allele at Chr2_1:28577524:
.vcf: [A]
.vcf: [ATATTATTTTACTATGCAAATG] <- (ALT)
.fa: [G]TATTATTTGCAAACGTATAGCCGGGCGGCTATACTGTTTAAATGCGGCGGTACTATAACACTTTATAAACACACCCAAAACCCATCATTACACACACTCAAAACTCATTTATAAACACACCCAAAAAGTTGACTTTAGGGTTAATTTTGGGTGTGTTTCTATGTTTAAATAGTGCTTGGGTTTTTTTATAAATACATGTCTAGGATTGGGTTTATTTATAAATTTGTATTAAATCTATTCTTTTTAAACGTACAACCGCGCGGCTATAATATTTACAACGATGATAAAGGGTTTCTTTTTGTCATCATCCTCAGCCATGAGTTCTGTCATAGACACTCTATTTACTTAAGTTTACAATGTAAATAAGGAAGTATCCCCTATTTGGATTCAAATAAAAATGCTAGAAAATCAAATTCCCACCAAATCAAAATATAAAAAATCGGTTTTAGTGCAAAATACGATTTAGGCTAAAAATGATGGCTCATTAAGTCAATATATACTTTATACTAAAATTCCATAAAATCAAGTTTTCTTATTTGATGTGTAAAGAATAAAAGCCGCCAAAAATTATCTTGAGAAAATGATTATTTTGACAAACCATTTTTCATACTTAGTCAATATTTTTATATAAAATATTTTTTTCATGTATGATATGAATGCATGAAGGGACCTAAGGTTTTTTTTAGTTTGTGAAATTTTGATTTTTTTTCTTTCTATTGGGTTTAATAGGGGAAAAGGCTTTAAAGATATTTGCTAAATCGCTACTCTTTGTCTATCTCTTACAATTTTTCTTGCTTAAAATGTATTTGTCTATCTATTTGTCGAGGACAATTATGATTGCAACCAATAAGCAATAAATTCTTGACATATGTGATATATATATATATATACTATTTTTCGTATGTATTGTGAGTTCGAACTTTTGATTCTTTATAATTTATAAGAGGCCCCCACACACATGAAATCATGACTTCGCCATTGGTTCTGTTAATGGGGTTTTGTAAGATTCAGTTTA

Sincerely,

Clarence

[pd3]

You are using a very old version of bcftools, we are at 1.21 now.

If the problem persists, the error message indicates that the allele in the REF column does not match the corresponding base in the fasta reference file. So possibly a reference build mismatch, the fasta file does not correspond to the VCF.