Skip to content

Latest commit

 

History

History
70 lines (64 loc) · 4.27 KB

SeqPurge.md

File metadata and controls

70 lines (64 loc) · 4.27 KB
Raw

SeqPurge tool help

SeqPurge (2024_08-110-g317f43b9)

Removes adapter sequences from paired-end sequencing data.

Mandatory parameters:
  -in1 <filelist>          Forward input gzipped FASTQ file(s).
  -in2 <filelist>          Reverse input gzipped FASTQ file(s).
  -out1 <file>             Forward output gzipped FASTQ file.
  -out2 <file>             Reverse output gzipped FASTQ file.

Optional parameters:
  -a1 <string>             Forward adapter sequence (at least 15 bases).
                           Default value: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCA'
  -a2 <string>             Reverse adapter sequence (at least 15 bases).
                           Default value: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT'
  -match_perc <float>      Minimum percentage of matching bases for sequence/adapter matches.
                           Default value: '80'
  -mep <float>             Maximum error probability of insert and adapter matches.
                           Default value: '1e-06'
  -qcut <int>              Quality trimming cutoff for trimming from the end of reads using a sliding window approach. Set to 0 to disable.
                           Default value: '15'
  -qwin <int>              Quality trimming window size.
                           Default value: '5'
  -qoff <int>              Quality trimming FASTQ score offset.
                           Default value: '33'
  -ncut <int>              Number of subsequent Ns to trimmed using a sliding window approach from the front of reads. Set to 0 to disable.
                           Default value: '7'
  -min_len <int>           Minimum read length after adapter trimming. Shorter reads are discarded.
                           Default value: '30'
  -threads <int>           The number of threads used for trimming (up to three additional threads are used for reading and writing).
                           Default value: '1'
  -out3 <file>             Name prefix of singleton read output files (if only one read of a pair is discarded).
                           Default value: ''
  -summary <file>          Write summary/progress to this file instead of STDOUT.
                           Default value: ''
  -qc <file>               If set, a read QC file in qcML format is created (just like ReadQC).
                           Default value: ''
  -block_size <int>        Number of FASTQ entries processed in one block.
                           Default value: '10000'
  -block_prefetch <int>    Number of blocks that may be pre-fetched into memory.
                           Default value: '32'
  -ec                      Enable error-correction of adapter-trimmed reads (only those with insert match).
                           Default value: 'false'
  -debug                   Enables debug output (use only with one thread).
                           Default value: 'false'
  -progress <int>          Enables progress output at the given interval in milliseconds (disabled by default).
                           Default value: '-1'
  -compression_level <int> Output FASTQ compression level from 1 (fastest) to 9 (best compression).
                           Default value: '1'

Special parameters:
  --help                   Shows this help and exits.
  --version                Prints version and exits.
  --changelog              Prints changeloge and exits.
  --tdx                    Writes a Tool Definition Xml file. The file name is the application name with the suffix '.tdx'.
  --settings [file]        Settings override file (no other settings files are used).

SeqPurge changelog

SeqPurge 2024_08-110-g317f43b9

2022-07-15 Improved scaling with more than 4 threads and CPU usage.
2019-03-26 Added 'compression_level' parameter.
2019-02-11 Added writer thread to make SeqPurge scale better when using many threads.
2017-06-15 Changed default value of 'min_len' parameter from 15 to 30.
2016-08-10 Fixed bug in binomial calculation (issue #1).
2016-04-15 Removed large part of the overtrimming described in the paper (~75% of reads overtrimmed, ~50% of bases overtrimmed).
2016-04-06 Added error correction (optional).
2016-03-16 Version used in the SeqPurge paper: http://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-016-1069-7

back to ngs-bits