-
Notifications
You must be signed in to change notification settings - Fork 22
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
Restored hipstr_merged.vcf from previous commit and added it to the c…
…urrent commit
- Loading branch information
Showing
1 changed file
with
126 additions
and
0 deletions.
There are no files selected for viewing
126 changes: 126 additions & 0 deletions
126
trtools/testsupport/sample_vcfs/mergeSTR_vcfs/hipstr_merged.vcf
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,126 @@ | ||
| ##fileformat=VCFv4.1 | ||
| ##command=HipSTR-v0.5 --bams /storage/gtex-data/wgs/SRR2163846.bam --fasta /storage/resources/Homo_sapiens_assembly19.fasta --regions /storage/resources/GRCh37.hipstr_reference.bed --min-reads 5 --str-vcf /storage/vcfs/SRR2163846.vcf.gz --def-stutter-model --log /storage/vcfs/SRR2163846.log.txt | ||
| ##command=HipSTR-v0.5 --bams /storage/gtex-data/wgs/SRR2163846.bam --fasta /storage/resources/Homo_sapiens_assembly19.fasta --regions /storage/resources/GRCh37.hipstr_reference.bed --min-reads 5 --str-vcf /storage/vcfs/SRR2163846.vcf.gz --def-stutter-model --log /storage/vcfs/SRR2163846.log.txt | ||
| ##command=/Users/yang/Desktop/TRTools/trtools/mergeSTR/mergeSTR.py --vcfs trtools/testsupport/sample_vcfs/mergeSTR_vcfs/test_file_hipstr1.vcf.gz,trtools/testsupport/sample_vcfs/mergeSTR_vcfs/test_file_hipstr2.vcf.gz --vcftype hipstr --out trtools/testsupport/sample_vcfs/mergeSTR_vcfs/hipstr_merged | ||
| ##contig=<ID=1,length=249250621> | ||
| ##contig=<ID=2,length=243199373> | ||
| ##contig=<ID=3,length=198022430> | ||
| ##contig=<ID=4,length=191154276> | ||
| ##contig=<ID=5,length=180915260> | ||
| ##contig=<ID=6,length=171115067> | ||
| ##contig=<ID=7,length=159138663> | ||
| ##contig=<ID=8,length=146364022> | ||
| ##contig=<ID=9,length=141213431> | ||
| ##contig=<ID=10,length=135534747> | ||
| ##contig=<ID=11,length=135006516> | ||
| ##contig=<ID=12,length=133851895> | ||
| ##contig=<ID=13,length=115169878> | ||
| ##contig=<ID=14,length=107349540> | ||
| ##contig=<ID=15,length=102531392> | ||
| ##contig=<ID=16,length=90354753> | ||
| ##contig=<ID=17,length=81195210> | ||
| ##contig=<ID=18,length=78077248> | ||
| ##contig=<ID=19,length=59128983> | ||
| ##contig=<ID=20,length=63025520> | ||
| ##contig=<ID=21,length=48129895> | ||
| ##contig=<ID=22,length=51304566> | ||
| ##contig=<ID=X,length=155270560> | ||
| ##contig=<ID=Y,length=59373566> | ||
| ##contig=<ID=MT,length=16569> | ||
| ##contig=<ID=GL000207.1,length=4262> | ||
| ##contig=<ID=GL000226.1,length=15008> | ||
| ##contig=<ID=GL000229.1,length=19913> | ||
| ##contig=<ID=GL000231.1,length=27386> | ||
| ##contig=<ID=GL000210.1,length=27682> | ||
| ##contig=<ID=GL000239.1,length=33824> | ||
| ##contig=<ID=GL000235.1,length=34474> | ||
| ##contig=<ID=GL000201.1,length=36148> | ||
| ##contig=<ID=GL000247.1,length=36422> | ||
| ##contig=<ID=GL000245.1,length=36651> | ||
| ##contig=<ID=GL000197.1,length=37175> | ||
| ##contig=<ID=GL000203.1,length=37498> | ||
| ##contig=<ID=GL000246.1,length=38154> | ||
| ##contig=<ID=GL000249.1,length=38502> | ||
| ##contig=<ID=GL000196.1,length=38914> | ||
| ##contig=<ID=GL000248.1,length=39786> | ||
| ##contig=<ID=GL000244.1,length=39929> | ||
| ##contig=<ID=GL000238.1,length=39939> | ||
| ##contig=<ID=GL000202.1,length=40103> | ||
| ##contig=<ID=GL000234.1,length=40531> | ||
| ##contig=<ID=GL000232.1,length=40652> | ||
| ##contig=<ID=GL000206.1,length=41001> | ||
| ##contig=<ID=GL000240.1,length=41933> | ||
| ##contig=<ID=GL000236.1,length=41934> | ||
| ##contig=<ID=GL000241.1,length=42152> | ||
| ##contig=<ID=GL000243.1,length=43341> | ||
| ##contig=<ID=GL000242.1,length=43523> | ||
| ##contig=<ID=GL000230.1,length=43691> | ||
| ##contig=<ID=GL000237.1,length=45867> | ||
| ##contig=<ID=GL000233.1,length=45941> | ||
| ##contig=<ID=GL000204.1,length=81310> | ||
| ##contig=<ID=GL000198.1,length=90085> | ||
| ##contig=<ID=GL000208.1,length=92689> | ||
| ##contig=<ID=GL000191.1,length=106433> | ||
| ##contig=<ID=GL000227.1,length=128374> | ||
| ##contig=<ID=GL000228.1,length=129120> | ||
| ##contig=<ID=GL000214.1,length=137718> | ||
| ##contig=<ID=GL000221.1,length=155397> | ||
| ##contig=<ID=GL000209.1,length=159169> | ||
| ##contig=<ID=GL000218.1,length=161147> | ||
| ##contig=<ID=GL000220.1,length=161802> | ||
| ##contig=<ID=GL000213.1,length=164239> | ||
| ##contig=<ID=GL000211.1,length=166566> | ||
| ##contig=<ID=GL000199.1,length=169874> | ||
| ##contig=<ID=GL000217.1,length=172149> | ||
| ##contig=<ID=GL000216.1,length=172294> | ||
| ##contig=<ID=GL000215.1,length=172545> | ||
| ##contig=<ID=GL000205.1,length=174588> | ||
| ##contig=<ID=GL000219.1,length=179198> | ||
| ##contig=<ID=GL000224.1,length=179693> | ||
| ##contig=<ID=GL000223.1,length=180455> | ||
| ##contig=<ID=GL000195.1,length=182896> | ||
| ##contig=<ID=GL000212.1,length=186858> | ||
| ##contig=<ID=GL000222.1,length=186861> | ||
| ##contig=<ID=GL000200.1,length=187035> | ||
| ##contig=<ID=GL000193.1,length=189789> | ||
| ##contig=<ID=GL000194.1,length=191469> | ||
| ##contig=<ID=GL000225.1,length=211173> | ||
| ##contig=<ID=GL000192.1,length=547496> | ||
| ##contig=<ID=NC_007605,length=171823> | ||
| ##INFO=<ID=INFRAME_PGEOM,Number=1,Type=Float,Description="Parameter for in-frame geometric step size distribution"> | ||
| ##INFO=<ID=INFRAME_UP,Number=1,Type=Float,Description="Probability that stutter causes an in-frame increase in obs. STR size"> | ||
| ##INFO=<ID=INFRAME_DOWN,Number=1,Type=Float,Description="Probability that stutter causes an in-frame decrease in obs. STR size"> | ||
| ##INFO=<ID=OUTFRAME_PGEOM,Number=1,Type=Float,Description="Parameter for out-of-frame geometric step size distribution"> | ||
| ##INFO=<ID=OUTFRAME_UP,Number=1,Type=Float,Description="Probability that stutter causes an out-of-frame increase in read's STR size"> | ||
| ##INFO=<ID=OUTFRAME_DOWN,Number=1,Type=Float,Description="Probability that stutter causes an out-of-frame decrease in read's STR size"> | ||
| ##INFO=<ID=BPDIFFS,Number=A,Type=Integer,Description="Base pair difference of each alternate allele from the reference allele"> | ||
| ##INFO=<ID=START,Number=1,Type=Integer,Description="Inclusive start coodinate for the repetitive portion of the reference allele"> | ||
| ##INFO=<ID=END,Number=1,Type=Integer,Description="Inclusive end coordinate for the repetitive portion of the reference allele"> | ||
| ##INFO=<ID=PERIOD,Number=1,Type=Integer,Description="Length of STR motif"> | ||
| ##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes"> | ||
| ##INFO=<ID=REFAC,Number=1,Type=Integer,Description="Reference allele count"> | ||
| ##INFO=<ID=AC,Number=A,Type=Integer,Description="Alternate allele counts"> | ||
| ##INFO=<ID=NSKIP,Number=1,Type=Integer,Description="Number of samples not genotyped due to various issues"> | ||
| ##INFO=<ID=NFILT,Number=1,Type=Integer,Description="Number of samples whose genotypes were filtered due to various issues"> | ||
| ##INFO=<ID=DP,Number=1,Type=Integer,Description="Total number of valid reads used to genotype all samples"> | ||
| ##INFO=<ID=DSNP,Number=1,Type=Integer,Description="Total number of reads with SNP phasing information"> | ||
| ##INFO=<ID=DSTUTTER,Number=1,Type=Integer,Description="Total number of reads with a stutter indel in the STR region"> | ||
| ##INFO=<ID=DFLANKINDEL,Number=1,Type=Integer,Description="Total number of reads with an indel in the regions flanking the STR"> | ||
| ##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype"> | ||
| ##FORMAT=<ID=GB,Number=1,Type=String,Description="Base pair differences of genotype from reference"> | ||
| ##FORMAT=<ID=Q,Number=1,Type=Float,Description="Posterior probability of unphased genotype"> | ||
| ##FORMAT=<ID=PQ,Number=1,Type=Float,Description="Posterior probability of phased genotype"> | ||
| ##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Number of valid reads used for sample's genotype"> | ||
| ##FORMAT=<ID=DSNP,Number=1,Type=Integer,Description="Number of reads with SNP phasing information"> | ||
| ##FORMAT=<ID=PSNP,Number=1,Type=String,Description="Number of reads with SNPs supporting each haploid genotype"> | ||
| ##FORMAT=<ID=PDP,Number=1,Type=String,Description="Fractional reads supporting each haploid genotype"> | ||
| ##FORMAT=<ID=GLDIFF,Number=1,Type=Float,Description="Difference in likelihood between the reported and next best genotypes"> | ||
| ##FORMAT=<ID=DSTUTTER,Number=1,Type=Integer,Description="Number of reads with a stutter indel in the STR region"> | ||
| ##FORMAT=<ID=DFLANKINDEL,Number=1,Type=Integer,Description="Number of reads with an indel in the regions flanking the STR"> | ||
| ##FORMAT=<ID=AB,Number=1,Type=Float,Description="log10 of the allele bias pvalue, where 0 is no bias and more negative values are increasingly biased. 0 for all homozygous genotypes"> | ||
| ##FORMAT=<ID=FS,Number=1,Type=Float,Description="log10 of the strand bias pvalue from Fisher's exact test, where 0 is no bias and more negative values are increasingly biased. 0 for all homozygous genotypes"> | ||
| ##FORMAT=<ID=DAB,Number=1,Type=Integer,Description="Number of reads used in the AB and FS calculations"> | ||
| ##FORMAT=<ID=ALLREADS,Number=1,Type=String,Description="Base pair difference observed in each read's Needleman-Wunsch alignment"> | ||
| ##FORMAT=<ID=MALLREADS,Number=1,Type=String,Description="Maximum likelihood bp diff in each read based on haplotype alignments for reads that span the repeat region by at least 5 base pairs"> | ||
| #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT GTEX-R55C-0003 GTEX-R55C-0004 | ||
| 1 16717 STR_2 GGTGGTGGTGGGGGCGGTGGGGGTGGTG GGTGGTGGTGGGGGCGGTGGTGGTGCTG . . START=16717;END=16744;PERIOD=3 GT:GB:Q:PQ:DP:DSNP:PSNP:PDP:GLDIFF:DSTUTTER:DFLANKINDEL:AB:FS:DAB:ALLREADS:MALLREADS 0|1:0|0:1.0:0.5:121:0:0|0:96.95|24.05:29.31:3:15:-15.66:0.0:93:-23|1;0|64;1|2;9|5:0|52;9|2 0|0:0|0:1.0:0.5:121:0:0|0:96.95|24.05:29.31:3:15:-15.66:0.0:93:-23|1;0|64;1|2;9|5:0|52;9|2 |