Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

incorrect base pair indexing in pfme-scorer output #18

Open
ceheitsch opened this issue Oct 21, 2020 · 0 comments
Open

incorrect base pair indexing in pfme-scorer output #18

ceheitsch opened this issue Oct 21, 2020 · 0 comments
Labels
bug Something isn't working

Comments

@ceheitsch
Copy link

Compare output in issue #6 with the correct thermodynamic decomposition for the o.nivara tRNA sequence (GGGGAUAUAGCUCAGUUGGUAGAGCUCCGCUCUUGCAAGGCGGAUGUCAGCGGUUCGAGUCCGCUUAUCUCCA) under the default Turner99 branching parameters (a = 3.4, b = 0, c = 0.4, d = 1) from mfold:

http://unafold.rna.albany.edu/results/11/20Oct21-11-41-47/20Oct21-11-41-47_1.full_det.html

Can be reconstructed from http://unafold.rna.albany.edu/?q=mfold/RNA-Folding-Form if needed.

@maxieds maxieds added the bug Something isn't working label Oct 24, 2020
Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment
Labels
bug Something isn't working
Projects
None yet
Development

No branches or pull requests

2 participants