You signed in with another tab or window. Reload to refresh your session.You signed out in another tab or window. Reload to refresh your session.You switched accounts on another tab or window. Reload to refresh your session.Dismiss alert
Compare output in issue #6 with the correct thermodynamic decomposition for the o.nivara tRNA sequence (GGGGAUAUAGCUCAGUUGGUAGAGCUCCGCUCUUGCAAGGCGGAUGUCAGCGGUUCGAGUCCGCUUAUCUCCA) under the default Turner99 branching parameters (a = 3.4, b = 0, c = 0.4, d = 1) from mfold:
Compare output in issue #6 with the correct thermodynamic decomposition for the o.nivara tRNA sequence (GGGGAUAUAGCUCAGUUGGUAGAGCUCCGCUCUUGCAAGGCGGAUGUCAGCGGUUCGAGUCCGCUUAUCUCCA) under the default Turner99 branching parameters (a = 3.4, b = 0, c = 0.4, d = 1) from mfold:
http://unafold.rna.albany.edu/results/11/20Oct21-11-41-47/20Oct21-11-41-47_1.full_det.html
Can be reconstructed from http://unafold.rna.albany.edu/?q=mfold/RNA-Folding-Form if needed.
The text was updated successfully, but these errors were encountered: