bcgsc · creisle · Mar 10, 2022 · Mar 4, 2022 · Mar 4, 2022 · Mar 4, 2022
diff --git a/docs/background/citations.md b/docs/background/citations.md
@@ -23,6 +23,11 @@ Chen,X. et al. (2016) Manta: rapid detection of structural variants
     and indels for germline and cancer sequencing applications.
     Bioinformatics, 32, 1220--1222.
 
+## Chiu-2021
+
+Chiu,R. et al. (2021) Straglr: discovering and genotyping tandem repeat
+    expansions using whole genome long-read sequences. Genome Biol., 22, 224.
+
 ## Haas-2017
 
 Haas,B et al. (2017) STAR-Fusion: Fast and Accurate Fusion

diff --git a/docs/inputs/.pages b/docs/inputs/.pages
@@ -0,0 +1,4 @@
+nav:
+  - reference.md
+  - standard.md
+  - ...
diff --git a/docs/inputs/non_python_dependencies.md b/docs/inputs/non_python_dependencies.md
@@ -0,0 +1,28 @@
+# Non-python Dependencies
+
+MAVIS integrates with
+[SV callers](./sv_callers.md),
+[job schedulers](#job-schedulers), and
+[aligners](#aligners). While some of
+these dependencies are optional, all currently supported options are
+detailed below. The versions column in the tables below list all the
+versions which were tested for each tool. Each version listed is known
+to be compatible with MAVIS.
+
+## Job Schedulers
+
+MAVIS v3 uses [snakemake](https://snakemake.readthedocs.io/en/stable/) to handle job scheduling
+
+## Aligners
+
+Two aligners are supported [bwa](../../glossary/#bwa) and
+[blat](../../glossary/#blat) (default). These are both included in the docker image by default.
+
+| Name                                           | Version(s)              | Environment Setting       |
+| ---------------------------------------------- | ----------------------- | ------------------------- |
+| [blat](../../glossary/#blat)                   | `36x2` `36`             | `MAVIS_ALIGNER=blat`      |
+| [bwa mem <bwa>](../../glossary/#bwa mem <bwa>) | `0.7.15-r1140` `0.7.12` | `MAVIS_ALIGNER='bwa mem'` |
+
+!!! note
+    When setting the aligner you will also need to set the
+    [aligner_reference](../../configuration/settings/#aligner_reference) to match
diff --git a/docs/inputs/reference.md b/docs/inputs/reference.md
@@ -10,16 +10,16 @@ To improve the install experience for the users, different
 configurations of the MAVIS annotations file have been made available.
 These files can be downloaded below, or if the required configuration is
 not available,
-(instructions on generating the annotations file)[/inputs/reference/#generating-the-annotations-from-ensembl] can be found below.
+[instructions on generating the annotations file](/inputs/reference/#generating-the-annotations-from-ensembl) can be found below.
 
-| File Name (Type/Format)                                                                       | Environment Variable      | Download                                                                                                                                                                                                                                                      |
-| --------------------------------------------------------------------------------------------- | ------------------------- | ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- |
-| [reference genome](../../inputs/reference/#reference-genome) ([fasta](../../glossary/#fasta)) | `MAVIS_REFERENCE_GENOME`  | [![](../images/get_app-24px.svg) GRCh37/Hg19](http://hgdownload.cse.ucsc.edu/goldenPath/hg19/bigZips/chromFa.tar.gz) <br> [![](../images/get_app-24px.svg) GRCh38](http://hgdownload.cse.ucsc.edu/goldenPath/hg38/bigZips/hg38.tar.gz)                        |
+| File Name (Type/Format)                                                                       | Environment Variable      | Download                                                                                                                                                                                                                                                                        |
+| --------------------------------------------------------------------------------------------- | ------------------------- | ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- |
+| [reference genome](../../inputs/reference/#reference-genome) ([fasta](../../glossary/#fasta)) | `MAVIS_REFERENCE_GENOME`  | [![](../images/get_app-24px.svg) GRCh37/Hg19](http://hgdownload.cse.ucsc.edu/goldenPath/hg19/bigZips/chromFa.tar.gz) <br> [![](../images/get_app-24px.svg) GRCh38](http://hgdownload.cse.ucsc.edu/goldenPath/hg38/bigZips/hg38.tar.gz)                                          |
 | [annotations](../../inputs/reference/#annotations) ([JSON](../../glossary/#json))             | `MAVIS_ANNOTATIONS`       | [![](../images/get_app-24px.svg) GRCh37/Hg19 + Ensembl69](http://www.bcgsc.ca/downloads/mavis/v3/ensembl69_hg19_annotations.v3.json.gz) <br> [![](../images/get_app-24px.svg) GRCh38 + Ensembl79](http://www.bcgsc.ca/downloads/mavis/v3/ensembl79_hg38_annotations.v3.json.gz) |
-| [masking](../../inputs/reference/#masking-file) (text/tabbed)                                 | `MAVIS_MASKING`           | [![](../images/get_app-24px.svg) GRCh37/Hg19](http://www.bcgsc.ca/downloads/mavis/hg19_masking.tab)<br>[![](../images/get_app-24px.svg) GRCh38](http://www.bcgsc.ca/downloads/mavis/GRCh38_masking.tab)                                                       |
-| [template metadata](../../inputs/reference/#template-metadata) (text/tabbed)                  | `MAVIS_TEMPLATE_METADATA` | [![](../images/get_app-24px.svg) GRCh37/Hg19](http://hgdownload.cse.ucsc.edu/goldenPath/hg19/database/cytoBand.txt.gz)<br>[![](../images/get_app-24px.svg) GRCh38](http://hgdownload.cse.ucsc.edu/goldenPath/hg38/database/cytoBand.txt.gz)                   |
-| [DGV annotations](../../inputs/reference/#dgv-database-of-genomic-variants) (text/tabbed)     | `MAVIS_DGV_ANNOTATION`    | [![](../images/get_app-24px.svg) GRCh37/Hg19](http://www.bcgsc.ca/downloads/mavis/dgv_hg19_variants.tab)<br>[![](../images/get_app-24px.svg) GRCh38](http://www.bcgsc.ca/downloads/mavis/dgv_hg38_variants.tab)                                               |
-| [aligner reference](../../inputs/reference/#aligner-reference)                                | `MAVIS_ALIGNER_REFERENCE` | [![](../images/get_app-24px.svg) GRCh37/Hg19 2bit (blat)](http://hgdownload.cse.ucsc.edu/goldenPath/hg19/bigZips/hg19.2bit)<br>[![](../images/get_app-24px.svg) GRCh38 2bit (blat)](http://hgdownload.cse.ucsc.edu/goldenPath/hg38/bigZips/hg38.2bit)         |
+| [masking](../../inputs/reference/#masking-file) (text/tabbed)                                 | `MAVIS_MASKING`           | [![](../images/get_app-24px.svg) GRCh37/Hg19](http://www.bcgsc.ca/downloads/mavis/hg19_masking.tab)<br>[![](../images/get_app-24px.svg) GRCh38](http://www.bcgsc.ca/downloads/mavis/GRCh38_masking.tab)                                                                         |
+| [template metadata](../../inputs/reference/#template-metadata) (text/tabbed)                  | `MAVIS_TEMPLATE_METADATA` | [![](../images/get_app-24px.svg) GRCh37/Hg19](http://hgdownload.cse.ucsc.edu/goldenPath/hg19/database/cytoBand.txt.gz)<br>[![](../images/get_app-24px.svg) GRCh38](http://hgdownload.cse.ucsc.edu/goldenPath/hg38/database/cytoBand.txt.gz)                                     |
+| [DGV annotations](../../inputs/reference/#dgv-database-of-genomic-variants) (text/tabbed)     | `MAVIS_DGV_ANNOTATION`    | [![](../images/get_app-24px.svg) GRCh37/Hg19](http://www.bcgsc.ca/downloads/mavis/dgv_hg19_variants.tab)<br>[![](../images/get_app-24px.svg) GRCh38](http://www.bcgsc.ca/downloads/mavis/dgv_hg38_variants.tab)                                                                 |
+| [aligner reference](../../inputs/reference/#aligner-reference)                                | `MAVIS_ALIGNER_REFERENCE` | [![](../images/get_app-24px.svg) GRCh37/Hg19 2bit (blat)](http://hgdownload.cse.ucsc.edu/goldenPath/hg19/bigZips/hg19.2bit)<br>[![](../images/get_app-24px.svg) GRCh38 2bit (blat)](http://hgdownload.cse.ucsc.edu/goldenPath/hg38/bigZips/hg38.2bit)                           |
 
 If the environment variables above are set they will be used as the
 default values when any step of the pipeline script is called (including

diff --git a/docs/inputs/sv_callers.md b/docs/inputs/sv_callers.md
@@ -0,0 +1,158 @@
+# SV Callers
+
+MAVIS supports output from a wide-variety of SV callers. Assumptions are made for each tool based on interpretation of the output and the publications for each tool.
+
+## Configuring Conversions
+
+Adding a conversion step to your MAVIS run is as simple as adding that section to the input JSON config.
+
+The general structure of this section is as follows
+
+```jsonc
+{
+    "convert": {
+        "<ALIAS>": {
+            "file_type": "<TOOL OUTPUT TYPE>",
+            "name": "<TOOL NAME>",  // optional field for supported tools
+            "inputs": [
+                "/path/to/tool/output/file"
+            ]
+        }
+    }
+}
+```
+
+A full version of the input configuration file specification can be found in the [configuration](../configuration/general.md) section.
+
+## Supported Tools
+
+The tools and versions currently supported are given below. Versions listed indicate the version of the tool for which output files have been tested as input into MAVIS. MAVIS also supports a [general VCF input](#general-vcf-inputs).
+
+| SV Caller                                                                   | Version(s) Tested | Files used as MAVIS input                     |
+| --------------------------------------------------------------------------- | ----------------- | --------------------------------------------- |
+| [BreakDancer (Chen, 2009)](../../background/citations#chen-2009)            | `1.4.5`           | `Tools main output file(s)`                   |
+| [BreakSeq (Abyzov, 2015)](../../background/citations#abyzov-2015)           | `2.2`             | `work/breakseq.vcf.gz`                        |
+| [Chimerascan (Iyer, 2011)](../../background/citations#iyer-2011)            | `0.4.5`           | `*.bedpe`                                     |
+| [CNVnator (Abyzov, 2011)](../../background/citations#abyzov-2011)           | `0.3.3`           | `Tools main output file(s)`                   |
+| [CuteSV (Jiang, 2020)](../../background/citations#jiang-2020)               | `1.0.10`          | `*.vcf`                                       |
+| [DeFuse (McPherson. 2011)](../../background/citations#mcpherson-2011)       | `0.6.2`           | `results/results.classify.tsv`                |
+| [DELLY (Rausch, 2012)](../../background/citations#rausch-2012)              | `0.6.1` `0.7.3`   | `combined.vcf` (converted from bcf)           |
+| [Manta (Chen, 2016)](../../background/citations#chen-2016)                  | `1.0.0`           | `{diploidSV,somaticSV}.vcf`                   |
+| [Pindel (Ye, 2009)](../../background/citations#ye-2009)                     | `0.2.5b9`         | `Tools main output file(s)`                   |
+| [Sniffles (Sedlazeck, 2018)](../../background/citations#sedlazeck-2018)     | `1.0.12b`         | `*.vcf`                                       |
+| [STAR-Fusion (Haas, 2017)](../../background/citations#haas-2017)            | `1.4.0`           | `star-fusion.fusion_predictions.abridged.tsv` |
+| [Straglr (Chiu, 2021)](../../background/citations#chiu-2021)                |                   |                                               |
+| [Strelka (Saunders, 2012)](../../background/citations#saunders-2012)        | `1.0.6`           | `passed.somatic.indels.vcf`                   |
+| [Trans-ABySS (Robertson, 2010)](../../background/citations/#robertson-2010) | `1.4.8 (custom)`  | `{indels/events_novel_exons,fusions/*}.tsv`   | `<output_prefix>.bed` |
+
+!!! note
+    [Trans-ABySS](../../glossary/#trans-abyss): The trans-abyss version
+    used was an in-house dev version. However the output columns are
+    compatible with 1.4.8 as that was the version branched from.
+    Additionally, although indels can be used from both genome and
+    transcriptome outputs of Trans-ABySS, it is recommended to only use the
+    genome indel calls as the transcriptome indels calls (for versions
+    tested) introduce a very high number of false positives. This will slow
+    down validation. It is much faster to simply use the genome indels for
+    both genome and transcriptome.
+
+## [DELLY](../../glossary/#delly) Post-processing
+
+Some post-processing on the delly output files is generally done prior
+to input. The output BCF files are converted to a VCF file
+
+```bash
+bcftools concat -f /path/to/file/with/vcf/list --allow-overlaps --output-type v --output combined.vcf
+```
+
+## General VCF inputs
+
+Assuming that the tool outputting the VCF file follows standard
+conventions, then it is possible to use a
+[general VCF conversion](../../package/mavis/tools/vcf)
+that is not tool-specific. Given the wide variety in content for VCF files,
+MAVIS makes a number of assumptions and the VCF conversion may not work
+for all VCFs. In general MAVIS follows the [VCF 4.2
+specification](https://samtools.github.io/hts-specs/VCFv4.2.pdf). If the
+input tool you are using differs, it would be better to use a
+[custom conversion script](#custom-conversions).
+
+Using the general VCF tool with a non-standard tool can be done as follows
+
+```json
+{
+    "convert": {
+        "my_tool_alias": {
+            "file_type": "vcf",
+            "name": "my_tool",
+            "inputs": ["/path/to/my_tool/output.vcf"]
+        }
+    }
+}
+```
+
+### Assumptions on non-standard INFO fields
+
+- `PRECISE` if given, Confidence intervals are ignored if given in favour of exact breakpoint calls using pos and END as the breakpoint positions
+- `CT` values if given are representative of the breakpoint orientations.
+- `CHR2` is given for all interchromosomal events
+
+### Translating BND type Alt fields
+
+There are four possible configurations for the alt field of a BND type structural variant
+based on the VCF specification. These correspond 1-1 to the orientation types for MAVIS
+translocation structural variants.
+
+```text
+r = reference base/seq
+u = untemplated sequence/alternate sequence
+p = chromosome:position
+```
+
+| alt format | orients |
+| ---------- | ------- |
+| `ru[p[`    | LR      |
+| `[p[ur`    | RR      |
+| `]p]ur`    | RL      |
+| `ru]p]`    | LL      |
+
+## Custom Conversions
+
+If there is a tool that is not yet supported by MAVIS and you would like it to be, you can either add a [feature request](https://github.com/bcgsc/mavis/issues) to our GitHub page or tackle writing the conversion script yourself. Either way there are a few things you will need
+
+- A sample output from the tool in question
+- Tool metadata for the citation, version, etc
+
+### Logic Example - [Chimerascan](../../glossary/#chimerascan)
+
+The following is a description of how the conversion script for
+[Chimerascan](../../background/citations/#iyer-2011) was generated.
+While this is a built-in conversion command now, the logic could also
+have been put in an external script. As mentioned above, there are a
+number of assumptions that had to be made about the tools output to
+convert it to the
+[standard mavis format](../../inputs/standard/). Assumptions were then verified by reviewing at a series of
+called events in [IGV](../../glossary/#igv). In the current
+example, [Chimerascan](../../background/citations/#iyer-2011) output
+has six columns of interest that were used in the conversion
+
+- start3p
+- end3p
+- strand3p
+- start5p
+- end5p
+- strand5p
+
+The above columns describe two segments which are joined. MAVIS requires
+the position of the join. It was assumed that the segments are always
+joined as a [sense fusion](../../glossary/#sense-fusion). Using this
+assumption there are four logical cases to determine the position of the
+breakpoints.
+
+i.e. the first case would be: If both strands are positive, then the end
+of the five-prime segment (end5p) is the first breakpoint and the start
+of the three-prime segment is the second breakpoint
+
+### Calling a Custom Conversion Script
+
+Since MAVIS v3+ is run using [snakemake](https://snakemake.readthedocs.io/en/stable/) the simplest way to incorporate your custom conversion scripts is to modify the Snakefile and add them as rules.
diff --git a/src/mavis/convert/__init__.py b/src/mavis/convert/__init__.py
@@ -13,6 +13,7 @@
 from .cnvnator import convert_row as _parse_cnvnator
 from .constants import SUPPORTED_TOOL, TOOL_SVTYPE_MAPPING, TRACKING_COLUMN
 from .starfusion import convert_row as _parse_starfusion
+from .straglr import convert_row as _parse_straglr
 from .transabyss import convert_row as _parse_transabyss
 from .vcf import convert_file as read_vcf
 
@@ -142,6 +143,10 @@ def _convert_tool_row(
             {k: v for k, v in row.items() if k not in {'Type', 'Chr1', 'Chr2', 'Pos1', 'Pos2'}}
         )
 
+    elif file_type == SUPPORTED_TOOL.STRAGLR:
+
+        std_row.update(_parse_straglr(row))
+
     else:
         raise NotImplementedError('unsupported file type', file_type)
 

diff --git a/src/mavis/convert/constants.py b/src/mavis/convert/constants.py
@@ -27,6 +27,7 @@ class SUPPORTED_TOOL(MavisNamespace):
     CNVNATOR = 'cnvnator'
     STRELKA = 'strelka'
     STARFUSION = 'starfusion'
+    STRAGLR = 'straglr'
 
 
 TOOL_SVTYPE_MAPPING = {v: [v] for v in SVTYPE.values()}  # type: ignore

diff --git a/src/mavis/convert/straglr.py b/src/mavis/convert/straglr.py
@@ -0,0 +1,32 @@
+from typing import Dict
+
+from ..constants import COLUMNS, SVTYPE
+
+
+def convert_row(row: Dict) -> Dict:
+    """
+    Converts the fields from the original STRAGLR BED output into MAVIS definitions of an SV
+    Since STRAGLR defines regions where short tandem repeats exist we make the definitions here fairly
+    non-specific
+
+    See their github page for more details: https://github.com/bcgsc/straglr
+
+    BED Columns
+    - chrom: chromosome name
+    - start: start coordinate of locus
+    - end: end coordinate of locus
+    - repeat_unit: repeat motif
+    - allele<N>.size: where N={1,2,3...} depending on --max_num_clusters e.g. N={1,2} if --max_num_clusters==2 (default)
+    - allele<N>.copy_number
+    - allele<N>.support
+    """
+    return {
+        COLUMNS.break1_chromosome: row['chrom'],
+        COLUMNS.break2_chromosome: row['chrom'],
+        COLUMNS.break1_position_start: row['start'],
+        COLUMNS.break1_position_end: row['end'],
+        COLUMNS.break2_position_start: row['start'],
+        COLUMNS.break2_position_end: row['end'],
+        COLUMNS.untemplated_seq: None,
+        COLUMNS.event_type: SVTYPE.INS,
+    }
diff --git a/tests/data/straglr.bed b/tests/data/straglr.bed
@@ -0,0 +1,10 @@
+#chrom	start	end	repeat_unit	allele1:size	allele1:copy_number	allele1:support	allele2:size	allele2:copy_number	allele2:support
+chr11	776686	778078	CT	100.0	150.0	10	100.0	100.0	1
+chr10	3079216	3079421	AGAGGTCACCACCCCTTCCCAACAATCCAGTAACAATCC	100.0	150.0	10	100.0	100.0	1
+chr9	2080637	2081030	CTCCTTCCCTCCGCCCCCACCTCGGTCCCTGT	100.0	150.0	10	100.0	100.0	1
+chrX	244719	245293	CCCCGGGAACCGCCT	100.0	150.0	10	-	-	-
+chr7	284096	284233	GGT	100.0	150.0	10	-	-	-
+chr8	288173	290242	CCCTGCTCCGT	100.0	150.0	10	100.0	100.0	1
+chr3	2382228	2382908	CCGTGGGGGAGGCTGAGGCTATGGGGACT	100.0	100.0	10	-	-	-
+chr2	2427285	2427528	CCTCC	100.0	150.0	10	-	-	-
+chr2	2427953	2428216	GGAGG	100.0	150.0	10	100.0	100.0	1
diff --git a/tests/test_mavis/convert/test_convert.py b/tests/test_mavis/convert/test_convert.py
@@ -1,3 +1,4 @@
+import itertools
 import os
 import shutil
 import sys
@@ -47,6 +48,16 @@ def run_main(self, inputfile, file_type, strand_specific=False):
             result.setdefault(pair.data['tracking_id'], []).append(pair)
         return result
 
+    def test_straglr(self):
+        result = self.run_main(get_data('straglr.bed'), SUPPORTED_TOOL.STRAGLR, False)
+        assert len(result) == 9
+        for bpp in itertools.chain(*result.values()):
+            assert bpp.break1.chr == bpp.break2.chr
+            assert bpp.break1.start == bpp.break2.start
+            assert bpp.break1.end == bpp.break2.end
+            assert bpp.event_type == SVTYPE.INS
+            assert bpp.untemplated_seq is None
+
     def test_chimerascan(self):
         self.run_main(get_data('chimerascan_output.bedpe'), SUPPORTED_TOOL.CHIMERASCAN, False)