Perl script that finds the number of CAG repeats in a DNA sequence

#!/usr/bin/perl

# This program, CAGrepeats.pl, finds the number of CAG repeats in a DNA sequence
# Author: Noreen Brenner, based upon a program in the book Bioinformatics: Sequence and Genome Analysis, by David W. Mount

# store the dna sequence data 
# into the scalar variable $sequence

$sequence = "GATACGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG";

# count the number of CAG repeats using a regular expression

$counter++ foreach $sequence =~ /CAG/g;
$counter1++ foreach $sequence =~ /CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG/g;

# print the number of CAG repeats found
print "number of CAG repeats is ", $counter, "\n";
print "number of CAG repeats that are repeated 36 times is ", $counter1, "\n";



exit;